Tải về định dạng Word (189KB) Tải về định dạng PDF (3.5MB)

Tiêu chuẩn quốc gia TCVN 8400-27:2014 về Bệnh động vật - Quy trình chẩn đoán - Phần 27: Bệnh sán lá gan

TIÊU CHUẨN QUỐC GIA

TCVN 8400-27:2014

BỆNH ĐỘNG VẬT - QUY TRÌNH CHẨN ĐOÁN - PHẦN 27: BỆNH SÁN LÁ GAN

Animal diseases - Diagnostic procedure - Part 27: Fasciolosis

Lời nói đầu

TCVN 8400-27:2014 do Trung tâm Chn đoán Thú y Trung ương - Cục Thú y biên soạn, Bộ Nông nghiệp và Phát triển nông thôn đề nghị, Tổng cục Tiêu chuẩn Đo lường Chất lượng thm định, Bộ Khoa học và Công nghệ công bố.

 

BỆNH ĐỘNG VẬT - QUY TRÌNH CHẨN ĐOÁN - PHẦN 27: BỆNH SÁN LÁ GAN

Animal diseases - Diagnostic procedure - Part 27: Fasciolosis

CẢNH BÁO - Vic áp dụng tiêu chun này có thể liên quan đến các vật liệu, thiết bị và các thao tác gây nguy hiểm. Tiêu chuẩn này không th đưa ra được hết tt cả các vn đề an toàn liên quan đến vic sử dụng chúng. Người sử dụng tiêu chuẩn này phải tự thiết lập các thao tác an toàn sức khỏe thích hp và xác đnh khả năng áp dụng các giới hạn quy định trước khi sử dụng tiêu chuẩn.

1. Phạm vi áp dụng

Tiêu chun này quy định quy trình chẩn đoán bệnh sán lá gan trên gia súc.

2. Thuật ngữ và định nghĩa

2.1. Bnh sán lá gan (Fasciolosis)

Bệnh sán lá gan là một bệnh lây giữa người và động vật, do hai loài Fasciola hepaticaFasciola gigantica gây ra. Các sán này thường ký sinh ống dẫn mật, có khi cả phổi, tim, hạch lâm ba, tuyến tụy của gia súc, thậm chí trên cả người. Bệnh lây lan qua loài ký ch trung gian là ốc nước ngọt như Limnaea auricularia, L. swinhoci...

CHÚ THÍCH: bệnh thường thy thể mạn tính trên gia súc và vật nuôi, tuy nhiên gần đây bệnh nổi lên như một bệnh lý quan trọng người, ảnh hưởng sức khỏe cộng đồng.

2.2. ELISA (Enzymed Linked Immunosorbent Assay): phép thử miễn dịch liên kết enzyme.

2.3. PCR (Polymerase Chain Reaction): phản ứng chuỗi polymeraza.

2.4. TAE (tris acetate EDTA): dung dịch đệm axetat.

2.5. PBS (phosphate buffered saline): dung dịch đệm phosphat.

2.6. OD (optical density): mật độ quang học.

3. Thuốc thử và vật liệu thử

Chỉ sử dụng các thuốc thử có cấp độ tinh khiết phân tích được công nhận và nước cất hoặc nước có độ tinh khiết tương đương.

3.1. Dung dịch kẽm - mui (xem điều A.2 phụ lục A)

3.2. Cặp mi dùng để phát hiện sán lá gan (xem bng 1)

4. Thiết bị, dụng cụ

Sử dụng các thiết b, dụng cụ của phòng thử nghiệm sinh học và cụ thể như sau:

4.1. T lạnh âm sâu, có thể duy trì nhiệt độ từ âm 20 °C đến âm 80 °C.

4.2. Tủ lạnh, có thể duy trì nhiệt độ từ 2 °C đến 8 °C.

4.3. Kính hiển vi quang học, có độ phóng đại 40 lần, 100 lần, 400 lần.

4.4. T m, có th duy trì nhiệt độ 37 °C.

4.5. Cân phân tích, có th từ 0,1 g đến 10 g.

4.6. Máy ly tâm, có thể ly tâm với gia tốc 500 g, 1 000 g, 3 000 g.

4.7. Máy đọc ELISA.

4.8. Máy PCR.

4.9. Phiến kính.

4.10. Lamen.

4.11. Lưới lọc phân, có kích thước lỗ lọc 200 μm.

5. Cách tiến hành

5.1. Chẩn đoán lâm sàng

5.1.1. Đặc điểm dịch tễ

- Sán lá gan gây bệnh cho động vật ăn cỏ như trâu, bò, dê, cừu, ngoài ra bệnh còn gặp lợn và người;

- Bệnh xảy ra mọi lứa tuổi, mọi giống và không phân biệt tính biệt. Tỷ lệ và cường độ nhiễm sán tỷ lệ thuận với tuổi của động vật cảm nhiễm;

- Bệnh thường gặp ở vùng đồng bằng và miền núi, nht là những nơi lầy lội, ẩm thp, nước ngập quanh năm.

5.1.2. Triệu chứng

5.1.2.1. Thể cp tính

- Bệnh th cấp tính thưng gặp gia súc non. Bê, nghé, dê, cừu bỏ ăn, mệt mỏi, lười vận động, chướng hơi dạ cỏ, sau đó tiêu chảy dữ dội, phân lng màu xám, có mùi tanh. Chỉ vài ngày sau con vật nằm bệt và chết trong tình trạng mất nước, rối loạn điện giải và kiệt sức;

- Bệnh nặng hơn khi bê nghé nhiễm thứ phát các vi khun gây bệnh có sẵn trong đưng ruột như: Salmonella, E. coli, Proteus. Đôi khi, trâu bò chết cấp tính mà không biểu hiện triệu chứng;

- bê, nghé hoặc cừu non bệnh thường thấy ở trạng thái cấp hoặc cấp tỉnh, có hiện tượng xuất huyết do sán di hành hoặc nhiễm độc kế phát từ bệnh gây ra do Clostridium (viêm ruột hoại tử) hoặc bệnh Corynebacteria (áp xe gan);

- giai đoạn sớm và trong trường hp số lượng sán lá gan trong đường mật chưa có nhiều, các biểu hiện của bệnh thường ít được chú ý. Các biểu hiện có thể gặp là đau vùng thượng vị, sốt, nôn, tiêu chảy, ngứa.

5.1.2.2. Thể mạn tính

- Phổ biến ở trâu, bò, dê, cừu trưng thành được nuôi dưỡng tốt và sán đã ở giai đoạn trưng thành, ký sinh trong ống mật với số lượng ít. Triệu chứng thể mạn tính xuất hiện sau thể cấp tính nửa tháng tới hai tháng;

- Gia súc ăn ít, gầy còm, suy nhược;

- Con vật có biểu hiện thiếu máu, niêm mạc nhợt nhạt, lông xù xì, thủy thũng mi mắt, ngực;

- Tiêu chảy kéo dài, đôi khi táo bón, phân màu đen, mt dần khả năng sinh sản và làm việc;

- Gia súc có thể chết do suy kiệt.

5.1.3. Bnh tích

5.1.3.1. Thể cp tính

- Gan xuất huyết, trên mặt gan có khi thấy những đường đi của sán non làm thành những vệt đỏ thẫm dài từ 2 mm đến 4 mm, trong ống dẫn mật có sán non nhỏ, số lượng nhiu;

- Lớp thanh mạc xuất huyết nhẹ, đôi khi có tơ huyết;

- Khi nhiễm nặng thì viêm phúc mạc, gan xuất huyết nhiều, niêm mạc nhợt nhạt.

5.1.3.2. Thể mạn tính

- Viêm túi mật mạn tính, ống dẫn mật dày lên do mô liên kết tăng sinh;

- Thành ống mật có hiện tượng canxi hóa;

- Tổ chức gan tổn thương thoái hóa và cuối cùng là dẫn đến xơ gan. Những nơi mô gan bị phá hủy, có những đám màu vàng xám, khi kiểm tra dưới kính hin vi thy như mô gan mất màu;

- Bệnh thể mạn tính xuất hiện sán trưởng thành trong túi mật và ống dẫn mật.

5.2. Chẩn đoán trong phòng thí nghiệm

5.2.1. Ly mẫu

5.2.1.1. Lấy mẫu cho xét nghim kháng th

- Mẫu huyết thanh: sử dụng xy lanh vô trùng để ly 1 ml đến 5 ml máu tĩnh mạch c hoặc động mạch đuôi của trâu, bò, dê, cừu nghi mắc bệnh chưa tiêm vắc xin phòng bệnh sán lá gan. Máu lấy ra được chứa trong bơm tiêm, rút pit tông tạo khoảng trống (hoặc bơm máu vào ống nghiệm vô trùng), ghi ký hiệu mẫu trên bơm tiêm hoặc ống nghiệm rồi đặt nằm nghiêng 45° trong hộp đựng mẫu, để đông máu trong 1 h đến 2 h nhiệt độ bình thưng, tránh ánh nắng trực tiếp. Sau đó, cht huyết thanh sang ống nghiệm vô trùng khác (hoặc ống eppendorf) thực hiện xét nghiệm mô tả tại 5.2.3 - phát hiện kháng thể bằng phương pháp ELISA;

- Mẫu sữa: ly sữa trực tiếp ngay từ con vật hoặc lấy sữa đã vắt cho vào ống vô trùng có np đậy để thực hiện xét nghiệm mô tả tại 5.2.3 - phát hiện kháng thể bằng phương pháp ELISA.

5.2.1.2. Ly mẫu cho xét nghim kháng nguyên

- Mẫu phân: dùng túi nilon sạch, lộn ngược rồi đeo vào tay hoặc đeo găng tay bảo hộ, đưa tay vào trực tràng ly phân trực tiếp trong trực tràng con vật hoặc lấy phân con vật vừa thi ra ngoài môi trường, đựng mẫu phân lấy được vào lọ miệng rộng hoặc túi nilon sạch thực hiện xét nghiệm mô tả tại 5.2.2.1 - phát hiện kháng nguyên bằng phương pháp lắng cặn; 5.2.1.2 - phát hiện kháng nguyên bằng phương pháp lắng cặn - phù nổi; và 5.2.2.3 - phát hiện kháng nguyên bằng phương pháp ELISA;

- Trứng sán: thu hồi trong phân của gia súc bằng phương pháp lắng cặn hoặc lắng cặn - phù nổi thực hiện xét nghiệm mô tả tại 5.2.2.4 - phát hiện kháng nguyên bằng phương pháp PCR;

- Con sán: cắt nhỏ từng nhu mô gan hay bộc lộ ống dẫn mật, túi mật để lấy sán thực hiện xét nghiệm mô tả tại 5.2.2.4 - phát hiện kháng nguyên bằng phương pháp PCR.

5.2.1.3. Bảo quản mẫu

Trong quá trình vận chuyển phải bảo quản mẫu trong thùng bảo ôn (nhiệt độ từ 2 °C đến 8 °C) không quá 48 h. phòng thí nghiệm, nếu chưa xét nghiệm ngay, phải được giữ trong tủ lạnh âm sâu (4.1) đối với mẫu huyết thanh và t lạnh (4.2) đối với mẫu máu chống đông.

CHÚ THÍCH: không ly mu huyết thanh ở trâu bò đã được tiêm vắc xin phòng bệnh sán lá gan để xét nghiệm kháng thể vì các phương pháp trong tiêu chun này không phân biệt được kháng thể nhiễm tự nhiên hay kháng th do tiêm vắc xin.

5.2.2. Phát hiện kháng nguyên

5.2.2.1. Phát hiện kháng nguyên bng phương pháp lắng cặn

5.2.2.1.1. Nguyên tắc

Dựa vào sự chênh lệch khối lượng riêng giữa trứng sán lá gan và khối lượng riêng của nước, trứng sán lá gan có khối lượng riêng lớn sẽ chìm xuống.

CHÚ THÍCH: phương pháp này cho phép phát hiện trứng sán trong phân khi sán đã trưởng thành và thải trứng, tức là sau nhiễm từ 8 tuần đến 10 tuần.

5.2.2.1.2. Cách tiến hành

- Dùng cân phân tích (4.5) cân 3 g phân cần xét nghiệm, cho vào cốc thủy tinh hoặc cốc nhựa thứ nhất;

- Đổ 50 ml nước cất vào cốc chứa phân. Dùng đũa thủy tinh khuấy cho tan thành huyễn dịch;

- Dùng lưi lọc phân (4.11) lọc huyễn dịch cốc th nht chuyển sang cốc thứ hai và loại b cặn ln;

- Để lắng cốc thứ hai trong 3 min, đổ b phần nước phía trên và thu ly phần cặn;

- Thêm 50 ml nước cất vào cốc chứa phn cặn trên, khuấy đu;

- Đ lắng trong 3 min, đổ bỏ phần nước phía trên và thu lấy phn cặn;

- Thêm 50 ml nước sạch vào cốc chứa phần cặn, khuấy đều;

- Để lắng trong 3 min, đổ bỏ phần dung dịch phía trên và thu lấy phn cặn đổ vào đĩa petri;

- Kiểm tra trên kính hiển vi quang học (4.3) độ phóng đại 40 lần hoặc 100 lần.

CHÚ THÍCH: có thể giữ cặn trong đĩa petri ở 4 °C đ kiểm tra vào hôm sau.

5.2.2.1.3. Đọc kết quả

- Kết quả được coi là dương tính khi tìm thấy trứng sán lá gan, màu vàng chanh, trong chứa phôi bào xếp kín, kích thước chiều dài từ 0,11 mm đến 0,15 mm, chiều rộng từ 0,07 mm đến 0,08 mm;

- Cần phân biệt về kích thước và màu sắc giữa trứng sán lá gan với trứng sán lá dạ cỏ:

1) Sán lá dạ cỏ: trứng có màu tro, phôi bào xếp thành từng cụm, rời rạc, kích thước chiều dài từ 0,12 mm đến 0,19 mm và chiều rộng từ 0,07 mm đến 0,09 mm;

2) Sán lá gan: trứng có màu vàng chanh, phôi bào xếp kín, đều, kín vỏ trứng, có nắp, kích thước chiều dài từ 0,11 mm đến 0,15 mm và chiều rộng từ 0,07 mm đến 0,08 mm.

5.2.2.2. Phát hiện kháng nguyên bằng phương pháp lắng cặn - phù nổi

5.2.2.2.1. Nguyên tắc

Dựa vào khối lượng riêng giữa trứng sán lá gan và dung dch kẽm - muối (xem điều A.2 phụ lục A), trứng sán lá gan có khối lượng riêng nhỏ hơn sẽ nổi lên phía trên.

CHÚ THÍCH: Phương pháp này cho phép phát hiện trứng sán trong phân khi sán đã trưởng thành và thải trứng, tức là sau nhiễm từ 8 tuần đến 10 tuần.

5.2.2.2.2. Cách tiến hành

- Dùng cân phân tích (4.5) cân 4 g phân cho vào cốc nhựa có dung tích 100 ml;

- Đổ 50 ml dung dịch formol 1 % (xem điu A.3 phụ lục A) vào cốc chứa phân;

- Hòa nhuyễn dung dịch phân, lọc ba lần qua lưới lọc phân (4.11) để loại bỏ cặn ln;

- Đổ thêm 50 ml dung dịch formol 1 %, để dung dịch lắng ít nht 1 h;

- Đ phần dung dịch nổi phía trên, thu lấy phần cặn ri đổ vào ống có dung tích 15 ml;

- Ly tâm ống với gia tốc 1 000 g trong 5 min (4.6);

- Đổ dung dịch nổi phía trên;

- Cho dung dịch kẽm - muối (xem điu A.2 phụ lục A) đến cách mép ống 2 cm. Đào đều dung dịch phân trong ống;

- Ly tâm ống với gia tốc 500 g trong 5 min (4.6);

- Đ thêm dung dịch kẽm - muối (xem điều A.2 phụ lục A) đầy ng, phủ lamen (4.10) lên phía trên miệng ống và để yên 1 min;

- Nhc lamen lên cho vào phiến kính (4.9);

- Kiểm tra trên kính hiển vi quang học ở độ phóng đại 40 ln hoặc 100 làn (4.3).

5.2.2.2.3. Đọc kết quả

Kết quả được coi là dương tính khi tìm thấy trứng sán lá gan, màu vàng chanh, trong chứa phôi bào xếp kín, kích thước chiều dài từ 0,11 mm đến 0,15 mm, chiều rộng từ 0,07 mm đến 0,08 mm.

CHÚ THÍCH: do khối lượng riêng của dung dịch km - muối bão hòa cao do đó trứng có th b phá hủy, gây khó khăn cho việc chẩn đoán phân biệt với trứng sán lá dạ cỏ nên cn đọc kết quả ngay sau khi tiến hành các bước.

5.2.2.3. Phát hiện kháng nguyên bằng phương pháp ELISA

Hiện nay các kít ELISA thương mại đã có sẵn trên thị trưng dùng để phát hiện kháng nguyên sán lá gan trên trâu bò (xem phụ lục B).

5.2.2.4. Phát hiện kháng nguyên bng phương pháp PCR

5.2.2.4.1. Tách chiết ADN

- Xử lý mẫu

1) Sán lá gan: cắt một mẩu sán có kích thước khoảng 0,5 mm x 0,5 mm;

2) Trứng sán lá gan thu hồi từ phân gia súc bằng phương pháp lắng cặn hoặc phương pháp lắng cặn phù nổi;

3) Các mẫu trên rửa ba lần với dung dịch PBS 0,01 M pH 7,2, sau đó bảo quản trong etanol 70° ở nhiệt độ từ 4 °C đến 8 °C cho đến khi sử dụng.

- Tách chiết ADN: sử dụng kít tách chiết mô thương mại:

Các mẫu được cắt nhỏ, nghin nhuyễn bằng cối chày sứ, cho vào ống chứa 600 μl dung dịch đệm (Tris-HCl 100 mM, pH 8,0; EDTA 100 mM, pH 8,0; SDS 2 %; NaCl 150 mM và proteinase K 200 mg/ml), trộn đều, sau đó ủ ở nhiệt độ 56 °C trong 2 h hoặc qua đêm nhiệt độ 37 °C.

Lọc huyễn dịch qua màng lọc chuyển phần nưc lọc vào ống 2 ml, ly tâm dung dịch với gia tốc 3 000 g (4.6) trong 3 min. Bỏ phần nước trong phía trên, thu ly phần cặn.

5.2.2.4.2. Tiến hành phản ứng PCR

Phản ứng PCR xét nghiệm Fasciola hepatica trong quy trình này sử dụng các cặp mồi để phát hiện gen đích COX 1. Trình tự cặp mồi được nêu trong Bảng 1.

Bảng 1 - Trình tự cặp mi

Gen đích

Mồi

Trình tự cặp mồi 5’ - 3' F. hepatica

Kích c sản phẩm
bp

Chu trình nhiệt

COX1

Mồi xuôi

TATGTTTTGATTTTACCCGGG

405

Chu trình 30 vòng:

95 °C, 60 s; 56 °C, 90 s; 72 °C, 90 s

Mồi ngược

ATGAGCAACCACAAACCATGT

5.2.2.4.3. Hỗn hợp phản ứng và chu trình nhiệt

- Chun b hỗn hợp (master - mix) (ví dụ theo hướng dẫn bộ kit Qiagen của nhà sản xuất) với tổng lượng 50 μl bao gồm KCl 50mM; Tris-HCl 10mM (pH 9.0); Triton X - 100; dNTP 200 mM; MgCl2 2,5 mM; mồi xuôi 0,1 mM; mồi ngược 0,1 mM; Taq ADN 1,0 U.

GHI CHÚ: phn ứng PCR phải bao gồm mẫu kiểm tra, mẫu đi chứng dương và mẫu đi chứng âm.

5.2.2.4.4. Điện di sn phm PCR

Pha 1,2 g bột agarose (gel) với 100 ml TAE 1 X, rồi đun nóng trong lò vi sóng cho đến khi tan hoàn toàn. Khi hỗn hợp nguội bớt (khoảng 50 °C đến 60 °C), cho tiếp 2 μl etidium bromua vào. Sau đó đổ vào khay và cắm lược. Để gel cứng lại trong khoảng 1 h, rồi rút lược ra.

Đổ đầy dung dịch TAE 1 X vào bể điện di (đến vạch "full level"), đặt khay gel vào vị trí trong bể điện di. Pha 2 μl đệm tải mẫu với 15 μl của sản phẩm mẫu vừa khuếch đại, mẫu đối chứng dương, âm cho vào giếng của miếng gel.

Điện di gel ở 80 V đến 100 V trong 30 min đến 40 min. Đặt gel đã điện di vào máy chiếu UV có bước sóng 590 nm.

5.2.2.4.5. Đọc kết quả

- Mẫu dương tính khi hiển thị vạch sản phẩm giống như đi chứng dương và có kích thước 405 bp với điều kiện đối chng âm không có vạch sản phm xut hiện;

- Mẫu âm tính khi không có vạch sản phm xuất hiện và giống đối chứng âm;

- Mu nghi ngờ hiển thị vạch sản phẩm không rõ nét hoặc hiển thị nhiều hơn 1 vạch sản phm. Trường hợp này cần xét nghiệm lại hoặc sử dụng các phương pháp để khng định.

5.2.3. Phát hiện kháng thể bng phương pháp ELISA

Hiện nay các kít ELISA thương mại đã có sẵn trên thị trường dùng để phát hiện kháng thể sán lá gan trên trâu bò (xem phụ lục C).

CHÚ THÍCH: kít phát hiện kháng th sán lá gan không thể phân biệt được kháng th do nhiễm tự nhiên hay kháng th do tiêm vắc xin.

6. Kết luận

Gia súc được kết luận là mắc bệnh sán lá gan khi có các đặc điểm dịch tễ, triệu chứng và bệnh tích điển hình của bệnh và có kết qu xét nghiệm kháng nguyên hoặc kháng thể dương tính bằng một trong những phương pháp quy định trong tiêu chun này.

 

PHỤ LỤC A

(Quy định)

Môi trường và dung dịch thuốc thử cho phương pháp lắng cặn - phù nổi phát hiện trứng sán lá gan

A.1. Nước muối bão hòa, khối lượng riêng 1,2

 

Natri clorua (NaCl):

400 g

 

 

Nước:

1 lít

 

Dùng đũa thủy tinh khuấy đu cho đến khi muối khống tan được nữa thì ngừng.

A.2 Dung dịch kẽm - muối, khối lượng riêng 1,53

 

Kẽm clorua (ZnCl2)

1280 g

 

 

Nước

610 ml

 

 

Nước muối bão hòa

650 ml

 

A.3. Dung dịch formol 1 %

 

Formaldehyd:

1 ml

 

 

Nước ct:

99 ml

 

 

PHỤ LỤC B

(Tham khảo)

Phương pháp ELISA phát hiện kháng nguyên sán lá gan

B.1. Chuẩn bị nguyên liệu

- Dung dịch đệm pha loãng mẫu (5 X): pha loãng dung dịch đệm với nước ct đã khử ion theo tỷ lệ 1/5 (cho 20 ml dung dịch đệm 5 X vào 80 ml nước ct đã khử ion);

- Dung dịch rửa (20 X): pha loãng dung dịch rửa với nước cất đã khử ion theo tỷ lệ 1/20 (cho 50 ml dung dịch rửa 20X vào 950 ml nước cất đã khử ion);

- Kháng thể gắn enzyme biotin (50 X): pha loãng kháng thể gắn erxzyme biotin với dung dịch đệm đã pha loãng theo t lệ 1/50 (cho 20 μl kháng thể gắn enzyme biotin 50 X vào 980 μl dung dịch đệm đã pha loãng);

- Kháng thể gắn enzyme avidine - peroxidase (50 X): pha loãng kháng thể gắn enzyme avidine - peroxidase với dung dịch đệm đã pha loãng theo tỷ lệ 1/50 (cho 20 μl kháng thể gắn enzyme avidine - peroxidase 50 X vào 980 μl dung dịch đệm đã pha loãng);

- Pha loãng mẫu phân phân cần kiểm tra: dùng cân phân tích (4.5) cân 2 g phân, rồi cho 2 ml dung dịch đệm pha loãng sau khi đã pha loãng. Ly tâm với gia tốc 1 000 g trong 10 min (4.6). Thu lấy phần dịch nổi phía trên.

B.2. Cách tiến hành

- Nhỏ 100 μl mẫu phân đã pha loãng vào 2 giếng. Đi chứng dương cho vào 2 giếng (theo sơ đ đĩa phản ứng ELISA phát hiện kháng nguyên). Ph đĩa bằng giấy nhôm, giữ đĩa ở nhiệt độ phòng trong 2h;

- Rửa đĩa ba lần bằng dung dịch rửa đã pha loãng;

- Nhỏ 100 μl kháng thể gắn enzyme biotin đã pha loãng vào mỗi giếng, ủ đĩa nhiệt độ phòng trong 1 h;

- Rửa đĩa ba lần bằng dung dịch rửa đã pha loãng;

- Nhỏ 100 μl kháng thể gắn enzyme avidine - peroxidase đã pha loãng vào mỗi giếng, ủ dĩa nhiệt độ phòng trong 1 h;

- Rửa đĩa ba lần bằng dung dịch rửa đã pha loãng;

- Nh 100 μl TMB vào mỗi giếng, tránh ánh sáng;

- đĩa 10 min ở nhiệt độ phòng;

- Nh 50 μl dung dịch dừng phản ứng vào mỗi giếng;

- Đọc đĩa bước sóng 450 nm bằng máy đọc ELISA (4.7)

B.3. Đọc kết quả

OD =

OD mẫu

x 100

OD mẫu đối chứng dương

Trong đỏ:

- OD: là mật độ quang học của mẫu

- ∆ OD mẫu: giá trị trung bình giữa 2 giá tr OD của mẫu

- ∆OD mẫu đối chứng dương: giá trị trung bình giữa 2 giá trị OD của mẫu đối chứng dương:

1) Mẫu dương tính: OD của mẫu lớn hơn 7,99.

2) Mẫu âm tính: OD của mẫu nhỏ hơn 7,99.

CHÚ THÍCH: với mỗi bộ kit khác nhau thì ngưỡng OD đ đánh giá là khác nhau

Sơ đồ đĩa phản ứng ELISA phát hiện kháng nguyên

 

1

2

3

4

5

6

7

8

9

10

11

12

A

ĐC(+)

M4

M8

M12

M16

M20

M24

M28

M32

M36

M40

M44

B

ĐC(+)

M4

M8

M12

M16

M20

M24

M28

M32

M36

M40

M44

C

M1

M5

M9

M13

M17

M21

M25

M29

M33

M37

M41

M45

D

M1

M5

M9

M13

M17

M21

M25

M29

M33

M37

M41

M45

E

M2

M6

M10

M14

M18

M22

M26

M30

M34

M38

M42

M46

F

M2

M6

M10

M14

M18

M22

M26

M30

M34

M38

M42

M46

G

M3

M7

M11

M15

M19

M23

M27

M31

M35

M39

M43

M47

H

M3

M7

M11

M15

M19

M23

M27

M31

M35

M39

M43

M47

CHÚ THÍCH: các dòng A, C, E, G phủ kháng th đặc hiệu; các dòng B, D, F, H không phủ kháng th đặc hiệu

ĐC (+): đối chứng dương (có sẵn trong bộ kit)

Từ M1 đến M47: mẫu xét nghiệm từ số 1 đến số 47.

 

PHỤ LỤC C

(Tham khảo)

Phương pháp ELISA phát hiện kháng thể sán lá gan

Có thể sử dụng bộ kit có bán sẵn để phát hiện kháng thể sán lá gan có trong mẫu huyết thanh và sữa.

CHÚ THÍCH: do chi phí phát hiện kháng th sán lá gan bằng phương pháp ELISA cao nên thường dùng trong điều tra huyết thanh học.

C.1. Chuẩn bị nguyên liệu

- Dung dịch rửa (20 X): pha loãng dung dịch rửa với nước cát đã khử ion theo tỷ lệ 1/20 (cho 50 ml dung dịch rửa 20 X vào 950 ml nước cát đã khử ion);

- Kháng kháng thể gắn enzyme peroxidase (100 X): pha loãng kháng kháng thể gắn enzyme peroxidase với dung dịch đệm 1 theo tỷ lệ 1/100 (cho 10 μl kháng kháng thể gắn enzyme peroxidase 100 X vào 990 μl dung dịch đệm 1);

- Pha loãng mẫu:

1) Đối với mẫu đối chứng và đối chứng dương cần pha loãng theo t lệ 1/20 bằng dung dịch đệm 2);

2. Đối với mẫu huyết thanh kiểm tra: pha loãng mẫu huyết thanh cần kiểm tra theo tỷ lệ 1/20 bằng dung dịch đêm 2 (cho 10 μl huyết thanh cần kiểm tra (cho 10 μl mẫu huyết thanh cần kiểm tra vào 190 μl dung dịch đệm 2);

C.2. Cách tiến hành

- Nh vào hai giếng, mỗi giếng 200 μl đối chứng âm đã pha loãng;

- Nhỏ vào bốn giếng, mỗi giếng 200 μl đối chứng dương đã pha loãng;

- Nhỏ vào hai giếng, mỗi giếng 200 μl huyết thanh cn kiểm tra đã pha loãng;

- Hoặc nhỏ vào hai giếng, mỗi giếng 200 μl mẫu sữa không pha loãng (theo sơ đ, đĩa. phản ứng ELISA phát hiện kháng thể);

- Lắc đều đĩa; phủ đỉa bằng giấy nhôm hoặc giấy dính, ủ đĩa 1 h ở tủ ấm 37 °C (4.4);

- Rửa đĩa ba lần bằng dung dịch rửa đã pha loãng;

- Cho 100 μl kháng kháng thể gắn enzyme peroxidase đã pha loãng vào từng giếng, phủ đĩa và ủ t ấm 37 °C (4.4) trong vòng 30 min;

- Rửa đĩa ba lần bằng dung dịch rửa đã pha loãng;

- Cho 100 μl TMB vào từng giếng;

- Ủ đĩa 21 °C trong 20 min, tránh ánh sáng;

- Cho 100 μl dung dịch dừng phản ứng;

- Lắc đều đĩa cho đến khi có màu đồng nhất;

- Đọc đĩa bước sóng 450 nm bằng máy đọc ELISA (4.7)

C.3. Đánh giá kết quả

- OD hiệu chỉnh của mẫu = (OD của giếng phủ kháng nguyên đặc hiệu - OD của giếng chưa phủ kháng nguyên đặc hiệu);

- Kết quả tin cậy nếu thỏa mãn 2 điều kiện sau:

1) Giá trị OD trung bình hiệu chnh của đối chứng dương lớn hơn 0,35;

2) Tỷ lệ giữa OD trung bình hiệu chỉnh của đối chứng dương. và OD trung bình hiệu chỉnh của đối chứng âm không nhỏ hơn 3,5.

- Đối với mẫu kiểm tra, t lệ S/P tính như sau:

S/P (%) =

OD hiệu chỉnh của mẩu kiểm tra

x 100%

OD trung bình hiệu chuẩn của mẫu đối chứng dương

Kết quả S/P (%) được trình bày bảng sau:

S/P của mu kiểm tra
%

Độ nhiễm
(đối với từng cá thể)

Mức độ nhiễm bnh
(trong đàn)

Bằng hoặc lớn hơn 150

+++

Nhim nặng (lớn hơn 50 % nhiễm)

+++

Lớn hơn 80 đến 150

++

Nhiễm trung bình (từ 20 % đến 50 % nhiễm)

++

Lớn hơn 30 đến 80

+

Nhiễm thấp (ít hơn 20 % nhiễm)

+

Bằng hoặc nhỏ hơn 30

0

Không nhiễm hoặc nhiễm không đáng kể

0

CHÚ THÍCH: độ nhim (đối với từng cá th)

+++: nhiễm nặng

++: nhiễm trung bình

+: nhiễm thp

0: không nhim hoặc nhim không đáng k

Sơ đồ đĩa phản ứng ELISA phát hiện kháng thể

 

1

2

3

4

5

6

7

8

9

10

11

12

A

N

N

M6

M6

M14

M14

M22

M22

M30

M30

M38

M38

B

P

P

M7

M7

M15

M15

M23

M23

M31

M31

M39

M39

C

P

P

M8

M8

M16

M16

M24

M24

M32

M32

M40

M40

D

M1

M1

M9

M9

M17

M17

M25

M25

M33

M33

M41

M41

E

M2

M2

M10

M10

M18

M18

M26

M26

M34

M34

M42

M42

F

M3

M3

M11

M11

M19

M19

M27

M27

M35

M35

M43

M43

G

M4

M4

M12

M12

M20

M20

M28

M28

M36

M36

M44

M44

H

M5

M5

M13

M13

M21

M21

M29

M29

M37

M37

M45

M45

CHÚ THÍCH:

Cột 1, 3, 5, 7, 9, 11: phủ kháng nguyên đặc hiu

Cột 2, 4, 6, 8, 10: không phủ kháng nguyên đặc hiệu

N: đối chng âm (Có sẵn trong bộ kít)

P: đi chứng dương (Có sẵn trong bộ kit)

T M1 đến M45: mẫu xét nghiệm từ số 1 đến số 45

 

THƯ MỤC TÀI LIỆU THAM KHẢO

[1] Phạm Văn Khuê và Phan Lục, 1996. Giáo trình ký sinh trùng thú y. Nhà xuất bn Đại học Nông Nghiệp I, trang 53 - 64.

[2]. Marcela A.Cucher et all, Diagnosis of Fasciola hepatica in field-collected Lymnaea. columella. and Lymnaea viatrix snails, Veterinary Parasitology 137 (2006). 74-82PCR

[3]. Levecke B et all, Mixed Giardia duodenalis assemblage A, B, C and E infections in pet chinchillas (Chinchilla lanigera) in Flanders (Belgium). Veterinary Parasitology 2011 Apr 19;177(1-2):166-70. Epub 2010 Nov 21.

[4] http://www.biox.com/Default.aspx?tabid=64&udtid=46

[5] http://www.idexx.com/pubwebresources/pdf/en_us/livestock-poultry/fasciolosis-verification-test- insert.pdf

[6]. http://www.fao.org/wairdocs/ILRI/x5492E/x5492e05.htm

[7] JICA. Third edition, 2003. Standard Diagnostic Manual for livestock diseases in Thailand. p.73 - 74.

Tìm kiếm

Thông tin Tiêu chuẩn Việt Nam TCVN8400-27:2014
Loại văn bảnTiêu chuẩn Việt Nam
Số hiệuTCVN8400-27:2014
Cơ quan ban hành
Người ký***
Lĩnh vựcNông nghiệp
Ngày ban hành...
Ngày hiệu lực...
Tình trạng hiệu lựcKhông xác định
Cập nhật3 năm trước