Tải về định dạng Word (203.5KB) Tải về định dạng PDF (3.8MB)

Tiêu chuẩn quốc gia TCVN 8400-28:2014 về Bệnh động vật - Quy trình chẩn đoán - Phần 28: Bệnh viêm ruột hoại tử do vi khuẩn clostridium perfringens

TIÊU CHUẨN QUỐC GIA

TCVN 8400-28:2014

BỆNH ĐỘNG VẬT - QUY TRÌNH CHẨN ĐOÁN - PHẦN 28: BỆNH VIÊM RUỘT HOẠI TỬ DO VI KHUẨN CLOSTRIDIUM PERFRINGENS

Animal diseases - Diagnostic procedure - Part 28: Necrotic enteritis cause by clostridium perfringens

Li nói đầu

TCVN 8400-28:2014 do Trung tâm Chn đoán Thú y Trung ương - Cục Thú y biên soạn, Bộ Nông nghiệp và Phát triển nông thôn đề nghị, Tng cục Tiêu chun Đo lưng Chất lượng thm định, Bộ Khoa học và Công nghệ công bố.

 

BỆNH ĐỘNG VẬT - QUY TRÌNH CHN ĐOÁN - PHN 28: BỆNH VIÊM RUỘT HOẠI TỬ DO VI KHUN CLOSTRIDIUM PERFRINGENS

Animal diseases - Diagnostic procedure - Part 28: Necrotic Enteritis cause by Clostridium perfringens

CẢNH BÁO - Việc áp dụng tiêu chuẩn này có th liên quan đến các vật liệu, thiết b và các thao tác gây nguy hiểm cho ngưi xét nghiệm. Tiêu chuẩn này không th đưa ra được tt cả các vấn đề an toàn liên quan đến việc sử dụng chúng. Khi áp dụng tiêu chuẩn người sử dụng tiêu chuẩn phải tự thiết lập các thao tác phù hợp để đảm bảo an toàn sức khỏe và xác đnh khả năng áp dụng các giới hạn quy đnh.

1. Phạm vi áp dụng

Tiêu chun này quy định quy trình chn đoán bệnh viêm ruột hoại tử gà và lợn do vi khuẩn Clostridium perfringens gây ra.

2. Thuật ngữ và định nghĩa

Trong tiêu chun này sử dụng thuật ngữ và đnh nghĩa sau:

Bệnh viêm ruột hoại tử gà, ở lợn

Là bệnh truyền nhiễm, do vi khuẩn Clostridium perfringens typ A và/hoặc typ C. Bệnh xảy ra chủ yếu gà ít ngày tuổi, ở lợn con theo mẹ.

Clostridium perfringens (C. perfringens) là vi khun Gram dương, yếm khí có khả năng gây bệnh vật nuôi, động vật hoang dã và ở ngưi. Vi khuẩn C. perfringens có kh năng sản sinh 16 loại độc tố. Dựa vào khả năng sn sinh 4 loại độc tố chính là độc tố alpha (a), beta (β), epsilon (ε), lota (ι), vi khuẩn được chia thành 5 typ A, B, C, D, E (typ độc tố) (xem bảng 1).

Bảng 1 - Các typ độc t chính của vi khuẩn C. perfringens

Typ độc tố

a

β

ε

ι

A

+

-

-

-

B

+

+

+

-

C

+

+

-

-

D

+

-

+

-

E

+

-

-

+

CHÚ THÍCH: có sản sinh độc tố (+); không sản sinh độc t (-)

C. perfringens typ A thưng có ở trong đưng ruột của gà, lợn khoẻ vi số lượng nhỏ, khi gặp những điều kiện bất lợi như thay đi chế độ chăm sóc nuôi dưỡng, mật độ chăn nuôi cao hoặc nhiễm cầu trùng, vi khuẩn nhân lên nhanh chóng và sản sinh độc t (chủ yếu là độc tố α) gây viêm ruột hoại t.

C. perfringens typ C hiếm khi phân lập được từ gà khỏe, lợn khỏe và độc tố α và β được xác định là yếu tố độc lực chủ yếu trong quá trình sinh bệnh của C. perfringens typ C.

3. Thuốc thử và vật liệu thử

Chỉ sử dụng thuốc thử loại tinh khiết phân tích; sử dụng nước cất hoặc nước đã khử khoáng hoặc nước có độ tinh khiết tương đương không có Rnase, trừ các trường hợp có quy định khác.

3.1. Môi trường nước thịt

3.2. Thạch máu, thạch cơ bản được bổ sung từ 5 % đến 7 % máu cừu hoặc máu bê, hoặc máu thỏ (pha chế thạch theo hướng dẫn của nhà sản xuất).

3.3. Thạch máu Schaedler, thạch Schaedler được b sung từ 5 % đến 7 % máu cừu hoặc máu bê, hoặc máu thỏ (pha chế thạch theo hướng dẫn của nhà sản xuất).

3.4. Túi tạo khí CO2, đảm bảo từ 5 % đến 10 % CO2 trong dụng cụ nuôi cấy yếm khí.

3.5. Môi trường Thioglycolate.

3.6. Bộ thuốc nhuộm Gram (xem phụ lục A).

3.7. Nguyên liệu hóa cht cho các phản ứng sinh hóa (xem phụ lục B).

3.8. Nguyên liệu cho PCR (Polymerase Chain Reaction) (xem điều C.1 phụ lục C).

3.9. Môi trường TSC (tryptose sulfite cycloserine).

3.10. Thạch máu cơ bản hay thạch thưng.

3.11. Môi trường nước pepton.

4. Thiết bị, dụng cụ

Sử dụng các thiết b, dụng cụ của phòng thí nghiệm sinh học và cụ thể như sau:

4.1. Tủ m, có thể duy trì nhiệt độ 37 °C và bổ sung từ 5 % đến 10 % CO2.

4.2. Kính hiển vi quang học, có vật kính với độ phóng đại 10 lần, 40 lần, 100 ln.

4.3. Bình nuôi cấy vi khuẩn yếm khí và túi nuôi cy vi khuẩn yếm khí.

4.4. Máy li tâm, có thể li tâm với gia tốc 12 000 g.

4.5. Máy nhân gen (máy PCR).

4.6. Nồi hấp, có th duy trì ở nhiệt độ 115 °C, 121 °C.

4.7. Que cấy, vô trùng.

4.8. Que cy chích sâu, vô trùng.

4.9. Phiến kính, sạch.

4.10. Ống nghiệm, sạch, vô trùng.

4.11. Đèn cồn.

4.12. Màng lọc, có kích thước lỗ lọc 0,45 µm.

5. Cách tiến hành

5.1. Chẩn đoán lâm sàng

5.1.1. Bệnh viêm ruột hoại tử ở gà

5.1.1.1. Đặc điểm dịch t

- Bệnh viêm ruột hoại tử thưng xảy ra ở gà ít ngày tuổi từ 2 tun đến 5 tuần tuổi, gà tây từ 7 tuần đến 12 tuần tuổi nhưng cũng có thể xảy ra ở gà hậu b và gà đẻ.

- Bệnh lây lan qua đường thức ăn, nước uống do vi khuẩn C. perfringens có nhiều trong môi trường đất, thức ăn, phân, chất độn chuồng, rác, cht chứa đường ruột,...

- Tỷ lệ nhiễm bệnh viêm ruột hoại tử ở gà con có thể lên ti 50 %, ở gà thịt khoảng từ 13 % đến 37,3 %.

5.1.1.2. Triệu chứng lâm sàng

- Trong trường hợp cấp tính gà chết nhanh (từ 1 h đến 2 h) khi chưa biểu hiện triệu chng của bệnh. T lệ chết cao, có thể lên tới 50 %.

- Gà thường chết đột ngột, các triệu chứng lâm sàng thy được trong thi gian ngắn.

- Triệu chứng thường thấy của bệnh là gà bị tiêu chảy, phân nhiều nước, có màu đ, nâu đỏ, màu vàng hoặc lẫn thức ăn.

- Gà có biểu hiện ủ rũ, ăn ít, giảm tăng trọng, xác chết gầy và ướt.

5.1.1.3. Bệnh tích đại thể

- Bệnh tích thường quan sát thấy ở phần ruột non chủ yếu là ở không tràng và hi tràng. Niêm mạc ruột bị xuất huyết, hoại tử. Lớp chất nhày ở ruột có màu xám nâu đến vàng xanh lá cây hoc có màng giả.

- Thành ruột non và thỉnh thoảng ở đoạn manh tràng mỏng, dễ nát, giãn to và tích khí.

- Gan không to nhưng màu sắc thay đổi, có màu thẫm hoặc vàng hơn bình thường. Trên bề mặt gan có lấm tấm điểm hoại tử màu vàng.

- Lách có thể sưng to, sưng huyết hoặc xut huyết, có các điểm hoại tử.

- Thận có thể sưng to, biến màu có thể có các điểm hoại tử.

5.1.2. Bnh viêm ruột hoại tử ở lợn

5.1.2.1. Đặc đim dịch t

- Bệnh thường xảy ra ở lợn con dưới 7 ngày tuổi (t lệ mắc cao ở lợn 3 ngày tuổi).

- Bệnh có thể xuất hiện kế phát sau các nguyên nhân nguyên phát hoặc khi có yếu tố bt lợi xảy ra.

- Mầm bệnh có th lây truyền cho lợn con từ phân của lợn nái có chứa vi khuẩn.

- Tùy thuộc vào trạng thái miễn dịch của lợn và thể bệnh tỉ lệ chết có thể thay đổi, có thể từ 50 % đến 60 % có khi đến 100 %.

5.1.2.2. Triệu chứng lâm sàng

Th cấp tính

- Lợn có thể mắc bệnh ngay từ ngày tuổi đầu tiên.

- Lợn tiêu chy phân lẫn máu hoặc phân màu đỏ nâu lẫn các mảng niêm mạc ruột b hoại tử màu xám.

- Lợn con yếu, đi lại khập khiễng hay nằm một chỗ.

- Những con gần chết da bụng chuyển màu xanh, thân nhiệt hạ xuống 35 °C, vùng da bụng phù nề.

- Con vật gầy còm và thường chết từ 12 h đến 48 h sau khi xuất hiện triệu chng tiêu chảy. Tỷ lệ chết cao từ 50 % đến 100 %.

- Có trường hợp lợn có thể chết không có triệu chứng tiêu chảy.

- Ruột non xut huyết, sinh hơi thường ở vùng không tràng và hồi tràng, chất chứa có thể lẫn máu và các mảng hoại tử màu xám. Niêm mạc ruột màu đỏ hay đen.

- Dịch xoang bụng có màu đỏ.

Thể á cp tính

- Thường xảy ra ở lợn từ 5 ngày đến 7 ngày tuổi.

- Lợn tiêu chảy phân vàng không lẫn máu.

- B ăn, gầy còm và chết do mt nước.

Thể mạn tính

- Lợn tiêu chảy dai dẳng khoảng hơn một tuần.

-  Phân nhiều nước, màu vàng xám có lẫn chất nhày.

- Con vật gầy còm nhợt nhạt, không chết hoặc chết sau vài tuần, còi cọc sau khi khỏi triệu chứng.

5.1.2.3. Bệnh tích đại th

- Ruột non xuất huyết, thành ruột non mỏng, chứa đy khí, sinh hơi thường ở vùng không tràng và hồi tràng, cht chứa có thể lẫn máu và các mng hoại tử màu xám. Niêm mạc ruột màu đỏ hay đen.

- Ruột già giãn, nhợt nhạt, chất chứa nhão.

- Dịch xoang bụng có màu đỏ.

5.2. Chn đoán phòng thí nghiệm

5.2.1. Lấy mẫu

Bệnh phẩm bao gồm: ruột non, phân.

Bệnh phẩm ruột: lấy từ 10 cm đến 15 cm vùng một non (hồi tràng) có bệnh tích.

Bệnh phm phân: ly phân trực tiếp từ trực tràng (ly khoảng 10 g).

Cho mỗi loại bệnh phẩm vào từng lọ hay túi ni lon vô trùng riêng biệt, đậy kín, bảo quản trong điu kiện lạnh từ 2 °C đến 8 °C và gửi về phòng thí nghiệm chậm nhất 24 h sau khi ly mẫu.

Gửi kèm theo bệnh phm giấy yêu cầu xét nghiệm có ghi rõ triệu chứng, bệnh tích và đặc điểm dịch tễ.

5.2.2. Kiểm tra trực tiếp vi khuẩn từ mẫu bnh phẩm

Sử dụng phương pháp nhuộm Gram để kiểm tra hình thái vi khuẩn.

5.2.2.1. Cách làm tiêu bản

Dùng que cấy (4.7) lấy niêm mạc ruột (vùng niêm mạc ruột có bệnh tích của bệnh), phết lên phiến kính (4.9), để khô.

5.2.2.2. C đnh tiêu bản

Nhỏ cồn methanol ngập tiêu bản (xem 5.2.2.1), để khô.

Nhuộm Gram theo quy định của phụ lục A.

5.2.2.3. Quan sát hình thái vi khuẩn

Vi khuẩn bắt màu tím (màu Gram dương), trực khuẩn to, thẳng, hai đầu tròn, có kích thước từ (từ 0,6 µm đến 0,8 µm) x (từ 2 µm đến 4 µm), thường đứng riêng lẻ hay thành chui ngắn.

Bệnh phẩm nghi nhiễm bệnh khi có nhiều vi khun có hình thái đặc trưng của C. perfringens trên vi trường.

5.2.3. Phân lập vi khuẩn

Bệnh phẩm được nuôi cy trên môi trường thạch máu (3.2) hoặc thạch máu Schaedler (3.3), nuôi ở t m (4.1) trong điều kiện yếm khí (4.3) có b sung CO2 (3.4) từ 24 h đến 48 h.

(CHÚ THÍCH: các dụng cụ nuôi cy vi khun yếm khí, phương pháp bổ sung khí CO2 được thực hiện theo hướng dẫn của nhà sản xut).

Với bệnh phm phân, ngoài nuôi cấy vào các môi trường trên, nuôi cấy thêm vào môi trường chọn lọc như môi trường TSC (3.9).

Sau từ 24 h đến 48 h nuôi cấy, khun lạc trên môi trường thạch máu (3.2) và thạch máu Schaedler (3.3) có màu trắng xám đường kính từ 2 mm đến 4 mm, hơi vồng, tròn, bóng và có 2 vòng dung huyết (dung huyết kép). Vòng dung huyết phía trong rõ (dung huyết beta - β), vòng dung huyết phía ngoài mở (dung huyết alpha - a).

Trên môi trường TSC (3.9) khuẩn lạc C. perfringens có màu đen.

Dùng que cấy (4.7) ly khuẩn lạc nghi ng cấy vào môi trường nước thịt (3.1) hoặc môi trường Thioglycolate (3.5) trong điều kiện yếm khí (4.3) có bổ sung CO2 (3.4), nuôi ở tủ ấm (4.1), từ 24 h đến 48 h để kiểm tra hình thái và đặc tính sinh hóa.

5.2.4. Xác đnh vi khuẩn

5.2.4.1. Quan sát hình thái vi khuẩn

- Dùng que cấy (4.7) lấy khun lạc hòa đều vào giọt nước sinh lý trên phiến kính (4.9) hoặc lấy một vòng que cấy (4.7) canh trùng đã nuôi cấy vi khun dàn mỏng lên trên phiến kính (4.9), để khô và c định tiêu bản trên ngọn la đèn cồn (4.11).

- Tiêu bản sau khi đã được c định, nhuộm bằng phương pháp Gram (xem Phụ lục A).

- Vi khun bắt màu tím (màu Gram dương), trực khuẩn to, thẳng, hai đầu tròn, có kích thước (từ 0,6 µm đến 0,8 µm) x (từ 2 µm đến 4 µm), thường đứng riêng lẻ hay thành chuỗi ngắn.

5.2.4.2. Kim tra đặc tính sinh hóa

Xác định vi khuẩn C. perfringens dựa vào một số đặc tính sinh hóa được nêu trong bảng 2.

Bng 2 (tiếp theo) - Một s đặc tính sinh hóa của vi khuẩn C. perfringens

Tính chất

C. perfringens

Lecithinase

+

Lipase

-

Phân giải casein

+

Indole

-

Di động

-

Glucose

+

Lactose

+

Sucrose

+

Maltose

+

Salicin

-

Phản ứng CAMP* ngược

+

*CAMP: Christie - Atkins - Munch - Petersen

Tiến hành các phản ứng sinh hóa theo quy định tại Phụ lục B.

GHI CHÚ: Có thể sử dụng kit sinh hóa thương mại đ kim tra đặc tính của vi khun C. perfringens

5.2.4.3. Định typ và xác đnh độc t của vi khuẩn C. perfringens

Sử dụng phương pháp PCR với các cặp mồi đặc hiệu và chu trình nhiệt được nêu trong bảng 3.

Bảng 3 - Các cặp mồi và chu trình nhiệt cho PCR xác định độc t a, β, ε, ι

Độc t

Tên mồi

Trình tự từ đu 5’ tới 3’

Kích thước sản phẩm (bp)

Chu trình nhiệt

a

CPA Fw

GCTAATGTTACTGCCGTTGA

324

95 °C, 10 min;

40 chu trình:

(94 °C, 30 s;

53 °C, 90 s;

72 °C, 90 s)

72 °C, 10 min.

CPA Rv

CCTCTGATACATCGTGTAAG

β

Cpb Fw

GCGAATATGCTGAATCATCTA

196

Cpb Rv

GCAGGAACATTAGTATATCTTC

ε

Etx Fw

GCGGTGATATCCATCTATTC

655

Etx Rw

CCACTTACTTGTCCTACTAAC

ι

lap Fw

ACTACTCTCAGACAAGACAG

446

lap Rw

CTTTCCTTCTATTACTATACG

- Tiến hành phản ứng PCR theo quy định tại Phụ lục C.

- Vi khuẩn C. perfringens được xác định là typ A khi PCR dương tính với độc tố a; âm tính vi độc tố β, ε, ι.

- Vi khuẩn C. perfringens được xác định là typ C khi PCR dương tính với độc tố aβ; âm tính với độc tố ε.

6. Kết luận

Gà, lợn được xác định là mắc bệnh viêm ruột hoại tử do vi khuẩn C. perfringens khi có đủ các điều kiện sau:

- Có đặc điểm dịch tễ, triệu chng lâm sàng, bệnh tích đại thể của bệnh;

- Nhuộm tiêu bản niêm mạc ruột thấy nhiều vi khun có hình thái đặc trưng của vi khuẩn C. perfringens;

- Phân lập và giám định được vi khuẩn C. perfringens thuộc typ A hoặc typ C.

 

Phụ lục A

(Quy định)

Phương pháp nhuộm Gram

A.1 Thuốc thử

A.1.1 Dung dịch tím tinh thể

Tím tinh thể (C25H30N3CI)

Etanol 95 %

Amoni oxalat [(NH4)2C2O4.2H2O]

Nước

2,0 g

20,0 ml

0,8 g

80,0 ml

Hòa tan tím tinh thể trong etanol và hòa tan amoni oxalat trong nước. Sau đó, trộn 2 dung dịch này với nhau và lắc cho tan hết.

A.1.2 Dung dịch fuchsin đậm đặc

Fuchsin basic (C20H20CIN3)

Etanol 95 %

Phenol (C6H6O)

Nước

1 g

10 ml

5 g

100 ml

Khi dùng, pha loãng dung dịch fuchsin đậm đặc với nước theo tỉ lệ 1:10 (thể tích).

A.1.3 Dung dịch lugol

Kali iodua (KI)

lôt (l2) tinh thể

Nước

2 g

1 g

200 ml

Nghiền kali iodua và iôt tinh thể, cho nước vào từ từ và lc cho tan.

A.1.4 Cồn axeton

Etanol 95 %

Axeton (C2H6O)

3 phn

1 phần

A.2. Cách tiến hành

Nhỏ dung dịch tím tinh thể lên tiêu bản (đã c định), để từ 1 min đến 2 min sau đó rửa nước nhanh và để khô.

Nhỏ dung dịch lugol, để 1 min sau đó rửa nước nhanh và để khô.

Nh cồn axeton, rửa nước thật nhanh và để khô.

Nh dung dịch fuchsin loãng, để 1 min sau đó rửa nước rồi thm khô hoặc sấy khô.

A.3 Xem tiêu bản

Nhỏ 1 giọt dầu vào tiêu bản và xem tiêu bản bằng kính hiển vi (4.2) với vật kính độ phóng đại 100 lần.

 

Phụ lục B

(Quy định)

Phương pháp kiểm tra các đặc tính sinh hóa

B.1 Kiểm tra đặc tính sinh lecithinase và lipase

B.1.1 Môi trường thạch lòng đỏ trứng

Chuẩn bị môi trường thạch lòng đỏ trứng: sử dụng môi trường thạch máu cơ bản (3.10) có b sung huyễn dịch lỏng đỏ trứng (thương mại). Pha chế theo hướng dẫn của nhà sản xuất.

B.1.2 Cách tiến hành

Dùng que cấy (4.7) lấy khun lạc nghi ng cấy vào môi trường thạch lòng đỏ trứng (xem mục B.1.1), nuôi ở tủ ấm (4.1) trong điều kiện yếm khí (4.3) có bổ sung CO2 (3.4) và kiểm tra sau từ 24 h đến 48 h.

B.1.3 Đọc kết quả

B.1.3.1 Khả năng sinh lecithinase

- Dương tính: Có quầng m đục ở môi trường xung quanh khuẩn lạc;

- Âm tính: Không có quầng m đục ở môi trường xung quanh khuẩn lạc.

B.1.3.2 Khả năng sinh lipase

- Dương tính: Có lớp như ngọc trai hay vảy cá bao phủ khun lạc (có thể lan ra thạch xung quanh khun lạc);

- Âm tính: Không có lớp như ngọc trai hay vảy cá bao phủ khun lạc.

B.2 Phản ứng phân giải casein

B.2.1 Môi trường thạch casein

Thành phn môi trường:

- Sữa tách bơ (skim milk)          100 g

- Nước cất                                1000 ml

Chỉnh pH môi trường ở 6,8 ± 0,2.

Hòa các thành phần trên với nhau, lắc đều.

Chia ra các ống nghiệm (4.10), 10ml /1 ống nghiệm.

Hấp tiệt trùng trong nồi hấp (4.6) ở 121 °C trong 5 min.

B.2.2 Cách tiến hành

Dùng que cy lấy khuẩn lạc nghi ng cấy vào môi trường thạch casein (xem mục B.2.1), nuôi ở t ấm (4.1) trong điều kiện yếm khí (4.3) có bổ sung CO2 (3.4) đọc kết quả hàng ngày trong 5 ngày.

B.2.3 Đọc kết quả

- Phản ứng dương tính: sa đông vón có vn như mây (stormy clot).

- Phn ứng âm tính: sữa không đông vón.

Ghi chú: Kiểm tra phản ứng phân giải casein có thể sử dụng môi trường thương mại sữa Litmus (Litmus milk).

B.3 Phản ứng sinh hóa đường

B.3.1 Môi trường

Sử dụng môi trường nước pepton có đường gồm các thành phn:

- Nước pepton (3.11).

- Dung dịch chỉ thị màu bromocrezol.

Cho 0,2 g bromocrezol vào 100 ml etanol 90 % và lắc cho tan hết.

- Dung dịch đường

Pha đường với nước thành dung dịch 10 %, tiệt trùng môi trường bằng ni hp (4.6) ở 110 °C trong 15 min đến 20 min hoặc hp cách quãng 3 lần ở 100 °C trong 30 min hoặc lọc qua màng lọc (4.12)

Chun b môi trường:

Cho 0,1 ml chỉ thị màu bromocrezol vào 100 ml môi trường nước pepton, chia 4 ml vào mỗi ống nghiệm (4.10). Tiệt trùng bằng nồi hấp (4.6) ở 120 °C trong 30 min. Chnh pH môi trường ở 6,8 ± 0,2.

Pha môi trường nước pepton-đường: cho 0,4 ml dung dịch đường 10% vào ống nghiệm chứa 4ml nước pepton đã được hp tiệt trùng

B.3.2 Cách tiến hành

Dùng que cấy (4.7) lấy khun lạc nghi ng cấy vào các ống môi trường nước pepton - đường (xem mục B.3.1), để vào t ấm (4.1) trong điều kiện yếm khí (4.3) có bổ sung CO2 (3.4), đọc kết quả sau từ 24 h đến 48 h.

B.3.3 Đọc kết quả

- Phản ứng dương tính: Môi trường chuyển màu vàng;

- Phản ứng âm tính: Môi trường không thay đổi màu.

B.4 Kim tra khả năng sinh Indol

B.4.1 Thuốc thử Kovac’s

Paradimetyl aminobenzaldehyt               5 g

Cồn amylic (C6H11OH)                            75 ml

Axit clohydric đặc                                 25 ml

Trộn dung dịch paradimetyl aminobenzaldehyt vào cn amylic cho tan hết và để trong tủ lạnh 4 °C. Thêm từ từ 5 ml đến 10 ml HCI, trộn đều rồi để tủ lạnh, sau đó lại tiếp tục bổ sung HCI.

Bảo qun thuốc thử trong lọ màu, ở 4 °C.

B.4.2 Cách tiến hành

Dùng que cấy (4.7) lấy khuẩn lạc nghi ng cấy vào môi trường nước peptone (3.11) hoặc môi trường nước peptone (3.11) có bổ sung tryptophan, nuôi ở tủ m (4.1) trong điều kiện yếm khí (4.3).

Sau 24 h nuôi cấy, nhỏ từ 0,2 ml đến 0,3 ml dung dịch thuốc thử Kovac’s vào môi trường, lắc nhẹ.

B.4.3 Đọc kết quả

Phản ứng dương tính (sinh indol): xut hiện vòng màu đỏ phía trên môi trường.

Phản ứng âm tính (không sinh indol): không xuất hiện vòng màu đỏ.

B.5 Kiểm tra khả năng di động

B.5.1 Môi trường thạch lỏng

Thành phần môi trường:

Peptone            10 g

Meat extract      3 g

NaCI                 5 g

Agar                 4 g

Gelatin              80 g

Nước cất          1000 ml

Hòa gelatine vào nước để 30 min, bổ sung các thành phần khác, đun cho tan hoàn toàn.

Chia 6ml vào mỗi ống nghiệm (4.10).

Hấp tiệt trùng trong nồi hp (4.6) ở 115 °C trong 20 min.

GHI CHÚ: Kiểm tra khả năng di động và sinh indol có th sử dụng môi trường SIM (Sulfide Indole Motility) thương mại.

B.5.2 Cách tiến hành

- Dùng que cy chích sâu ly khuẩn lạc cần kiểm tra, chích thẳng xuống gần đáy của ống nghiệm môi trường thạch lỏng (xem mục B.5.1).

- Nuôi cấy ở tủ ấm (4.1) trong điều kiện yếm khí (4.3) có bổ sung CO2 (3.4), đọc kết quả sau từ 24 h đến 48 h.

B.5.3 Đọc kết quả

- Phn ứng dương tính (có khả năng di động): môi trường đục, không nhìn rõ đường cấy chích sâu;

- Phản ứng âm tính: môi trường trong và nhìn thấy đường cấy chích sâu.

B.6 Phản ứng CAMP ngược

B.6.1 Chuẩn bị

- Thạch máu cừu.

- Chủng vi khuẩn: Streptococcus agalactiae, vi khuẩn Clostridium perfringens nghi ng.

B.6.2 Tiến hành phản ứng

- Dùng que cấy (4.7) lấy khun lạc nghi ng Clostridium perfringens cấy thành 1 đường thẳng ngang mặt đĩa thạch.

- Dùng que cy (4.7) lấy khun lạc Streptococcus agalactiae cấy vuông góc nhưng không tiếp xúc (cách khoảng 2 mm) vi đường cy khuẩn lạc nghi ng Clostridium perfringens.

- Nuôi cấy ở t ấm (4.1) trong điều kiện yếm khí (4.3) có b sung CO2 (3.4), đọc kết qu sau 24 h.

B.6.3 Đọc kết quả

- Phn ứng dương tính: xut hiện mũi tên hướng về phía đường cấy Clostridium perfringen nghi ng.

- Phản ứng âm tính: không xuất hiện mũi tên hướng về phía đường cấy Clostridium perfringen nghi ngờ.

 

Phụ lục C

(Quy định)

Phương pháp PCR kiểm tra các yếu tố độc lực

C.1 Nguyên liệu PCR

C.1.1 Taq PCR Master Mix Kit

C.1.2 Cặp mồi (primers): mi xuôi và mồi ngược (xem bảng 3)

C.1.3 Nước tinh khiết không có nuclease

C.1.4 Dung dịch đệm TAE hoặc TBE

C.1.5 Ethidi bromua hoặc cht nhuộm màu SYBR green

C.1.6 Loading dye

C.1.7 ADN (Acid Deoxyribo Nucleic) chuẩn (Ladder, marker)

C.2 Chuẩn bị mẫu

Mẫu kiểm tra là vi khuẩn Clostridium perfringens đã nuôi cấy thun khiết trên thạch máu (3.2) ở tủ ấm (4.1) trong điều kiện yếm khí (4.3) có b sung CO2 (3.4), từ 24 h đến 48 h.

Đối chứng dương: chủng vi khun đã được giám định là Clostridium perfringens hoặc sử dụng các chủng Clostridium perfringens chuẩn.

C.3 Tách chiết ADN

Các vi khuẩn phân lập được từ mẫu bệnh phm và các mẫu đối chứng dương được tách chiết ADN bng các kit thương mại hoặc bằng phương pháp sốc nhiệt. Nếu sử dụng kit thì các bước tiến hành theo chỉ dẫn của nhà sn xuất.

Tách chiết bằng phương pháp sốc nhiệt: Lấy từ 3 khuẩn lạc đến 4 khuẩn lạc, hòa vào 100 μl nước vô trùng không chứa các enzym Rnase và se (nuclease free water). Đun sôi cách thủy trong 10 min rồi làm lạnh nhanh huyễn dịch trong đá 5 min. Ly tâm huyễn dịch bằng máy ly tâm (4.4) với gia tốc 12 000 g trong 4 min. Thu hoạch phần trong phía trên để thực hiện phản ứng PCR.

C.4 Tiến hành

Có th sử dụng các kit thương mại theo hưng dẫn của nhà sn xuất. Nên sử dụng Multiplex PCR kit.

Sử dụng cặp mồi và chu trình nhiệt trong Bảng 3.

Đối chứng dương: tách chiết từ vi khuẩn Clostridium perfringens (xem mục C.3).

Đối chứng âm: gồm đầy đủ thành phn của một phản ứng PCR, nhưng không có ADN của vi khun.

Tiến hành phản ứng PCR bằng máy nhân gen (4.5).

C.5 Chạy điện di

Sản phẩm PCR được chạy điện di trên thạch agarose 1,5 % đến 2 % trong dung dịch đệm TAE hoặc TBE.

Cho 2 µl dung dịch loading dye vào 8 µl sản phm PCR, trộn đều cho vào từng giếng trên bản thạch. Cho 10 µl thang chun (marker) vào một giếng.

Bản thạch được điện di trong môi trường dung dịch đệm TAE hoặc TBE (tùy thuộc vào loại dung dịch đệm sử dụng khi pha thạch), trong thi gian 30 min đến 40 min, ở 100 V.

Sau đó nhuộm bằng dung dịch ethidi bromua 0,2 mg / 100ml.

Có thể dùng các sản phẩm có sẵn chất nhuộm ADN để pha chế thạch agarose (ví dụ như SYBR safe ADN gel stain của hãng Invitrogen) và sử dụng theo quy định của nhà sản xuất.

C.6 Đọc kết quả

Phản ứng dương tính khi:

- Mẫu đối chứng dương có một vạch duy nhất đúng kích c của sản phm.

- Mẫu đối chứng âm: không xuất hiện vạch.

- Mẫu kiểm tra có vạch giống mẫu đối chứng dương.

Phản ứng âm tính khi:

- Mẫu đối chứng dương có một vạch duy nhất đúng kích cỡ của sản phẩm.

- Mẫu đi chứng âm: không xut hiện vạch.

- Mu kiểm tra không có vạch giống mu đối chứng dương.

 

THƯ MỤC TÀI LIỆU THAM KHẢO

[1] Nguyễn Bá Hiên, Huỳnh Thị Mỹ Lệ, Lê Văn Lãnh, Đỗ Ngọc Thúy, 2012. Giáo trình bệnh truyền nhiễm Thú y. Nhà xut bản Đại học Nông nghiệp, trang 431 - 434.

[2] A. Heikinheimo, H. Korkeala, 2005. Multiplex PCR assay for toxinotyping Clostridium perfringens isolates obtained from Finnish broiler chickens. Article first published online: 13 APR 2005; Volume 40, Issue 6, pages 407-411.

[3] Ahsani MR, Mohammadabadi MR, Shamsaddini MB (2010). Clostridium perfringens isolate typing by multiplex PCR. The Journal of Venomous Animals and Toxins including Tropical Diseases ISSN 1678-9199, volume 16, issue 4, p. 573-578.

[4] Arunava Das, Yahya Mazumder, Biman Kumar Dutta (2008). Clostridium perfringens Type A from Broiler Chicken with Necrotic Enteritis. International Journal of Poultry Science 7 (6), p. 601 - 609.

[5] Farzan A, Kircanski J, DeLay J, Soltes G, Songer JG, Friendship R, Prescott JF. 2013. An investigation into the association between cpb2-encoding Clostridium perfringens type A and diarrhea in neonatal piglets. Can J Vet Res. 77(1):45-53.

[6] JICA. Third edition, 2003. Standard Diagnostic Manual for livestock diseases in Thailand. p. 118 - 119; 181 - 182.

[7] J.Quinn, M.E.Carter, B.Markey, G.R.Carter, 2004. Chapter 17: Clostridium species. Veterinary Clinical Microbiology. 6th Edition. Printed in Spain, p.191 - 208.

[8] Kenneth Opengart, 2008. Chapter 22: Necrotic Enteritis. Clostridial Diseases. Diseases of Poultry. 12th Edition. Blackwell Publishing, p.872 - 879.

[9] Richard L.Wood, Louis M.Henderson, 2006. Chapter 36: Clostridial ilnfection. Diseases of Swine. 9th Edition. Blackwell Publishing, p. 613 - 619.

[10] Songer JG, Glock RD. 1998. Enteric intection of swine with Clostridium perfringens types A and C. Diagnostic Notes. Swine Health and Production 6 (5). p. 223-225.

[11] Van Asten AJAM, van der Wiel CW, Nikolaou G, Houwers DJ, Grone A (2009). A multiplex PCR for toxin typing of Clostridium pertringens. Vet Microbiol. 136 (1), p.411 - 412.

Tìm kiếm

Thông tin Tiêu chuẩn Việt Nam TCVN8400-28:2014
Loại văn bảnTiêu chuẩn Việt Nam
Số hiệuTCVN8400-28:2014
Cơ quan ban hành
Người ký***
Lĩnh vựcNông nghiệp
Ngày ban hành...
Ngày hiệu lực...
Tình trạng hiệu lựcKhông xác định
Cập nhật3 năm trước