Tải về định dạng Word (203KB) Tải về định dạng PDF (5.3MB)

Tiêu chuẩn quốc gia TCVN 8710-15:2015 về Bệnh thủy sản - Quy trình chẩn đoán - Phần 15: Bệnh nhiễm trùng do Aeromonas Hydrophila ở cá

TIÊU CHUẨN QUỐC GIA

TCVN 8710-15:2015

BỆNH THỦY SẢN - QUY TRÌNH CHẨN ĐOÁN -  PHẦN 15: BỆNH NHIỄM TRÙNG DO AEROMONAS HYDROPHILA Ở CÁ

Aquatic animal disease - Diagnostic procedure - Part 15: Aeromonas hydrophila infection in fish

Lời nói đầu

TCVN 8710-15:2015 do Trung tâm Chn đoán Thú y Trung ương - Cục Thú y biên soạn, Bộ Nông nghiệp và Phát triển nông thôn đề nghị, Tổng cục Tiêu chuẩn Đo lường Chất lượng thm định, Bộ Khoa học và Công nghệ công bố.

Bộ TCVN 8710 Bệnh thủy sản - quy trình chn đoán gồm 15 phần:

- TCVN 8710-01 : 2011, phần 1: Bệnh Còi do vi rút ở tôm;

- TCVN 8710-02 : 2011, phần 2: Bệnh Hoại t thần kinh ở cá biển;

- TCVN 8710-03 : 2011, phần 3: Bệnh Đốm trắng ở tôm;

- TCVN 8710-04 : 2011, phần 4: Bệnh Đầu vàng ở tôm;

- TCVN 8710-05 : 2011, phần 5: Bệnh Taura ở tôm He;

- TCVN 8710-06 : 2012, phần 6: Bệnh do Koi herpesvirus ở cá chép;

- TCVN 8710-07 : 2012, phần 7: Bệnh xuất huyết mùa xuân ở cá chép;

- TCVN 8710-08 : 2012, phần 8: Bệnh hoại tử cơ ở tôm;

- TCVN 8710-09 : 2012, phần 9: Bệnh hoại tử gan tụy ở tôm;

- TCVN 8710-10 : 2015, phần 10: Bệnh do Perkinsus marinus ở nhuyễn thể hai mảnh v;

- TCVN 8710-11 : 2015, phần 11: Bệnh do Perkinsus olseni ở nhuyễn thể hai mảnh vỏ;

- TCVN 8710-12 : 2015, phần 12: Bệnh do Vi bào t do Enterocytozoon hepatopenaei ở tôm;

- TCVN 8710-13 : 2015, phần 13: Bệnh gan tụy do Parvovirus ở tôm

- TCVN 8710-14 : 2015, phần 14: Hội chứng lở loét (EUS) ở cá;

- TCVN 8710-15 : 2015, phần 15: Bệnh nhiễm trùng do Aeromonas ở cá.

 

BỆNH THỦY SẢN - QUY TRÌNH CHẨN ĐOÁN - PHẦN 15: BỆNH NHIỄM TRÙNG DO AEROMONAS HYDROPHILA Ở CÁ

Aquatic animal disease - Diagnostic procedure - Part 15: Aeromonas hydrophila infection in fish

CẢNH BÁO - Việc áp dụng tiêu chuẩn này có thể liên quan đến các vật liệu, thiết bị và các thao tác gây nguy hiểm. Tiêu chuẩn này không thể đưa ra được hết tất cả các vấn đề an toàn liên quan đến việc s dụng chúng. Người s dụng tiêu chuẩn này phải tự thiết lập các thao tác an toàn sức khỏe thích hợp và xác định khả năng áp dụng các giới hạn quy định trước khi s dụng tiêu chuẩn.

1. Phạm vi áp dụng

Tiêu chuẩn này quy định quy trình chẩn đoán bệnh nhiễm trùng do Aeromonas hydrophila ở cá.

2. Thuật ngữ và định nghĩa

Trong tiêu chuẩn này sử dụng các thuật ngữ và định nghĩa sau:

2.1. Bệnh nhiễm trùng do Aeromonas hydrophila (Aeromonas hydrophila lnfection)

Bệnh nhiễm trùng máu, xuất huyết do Aeromonas hydrophila ở một số loài cá như cá ba sa, cá tra, cá trắm cỏ, cá rô phi, cá bống tượng...

CHÚ THÍCH: Aeromonas hydrophila là vi khuẩn gram âm, di động, hình que ngắn, hai đầu hơi tròn, đầu có một tiêm mao, không có nha bào, không có giác mạc, hiếu khí và yếm khí không bắt buộc, khử nitrat, có khả năng lên men, oxidase dương tính.

3. Thuốc thử và vật liệu thử

Chỉ sử dụng thuốc thử loại tinh khiết phân tích, sử dụng nước cất, nước khử khoáng hoặc nước có độ tinh khiết tương đương, trừ các trường hợp có quy định khác.

3.1. Thuốc thử và vật liệu thử dùng chung.

3.1.1. Etanol, từ 70 % (th tích), 90 % (thể tích) và etanol tuyệt đối.

3.2. Thuốc thử và vật liệu thử dùng cho phương pháp giám định sinh hóa.

3.2.1. Thạch dinh dưỡng (NA).

3.2.2. Thạch chọn lọc Aeromonas spp. (Rimler-Shotts - R-S).

3.2.3. Thuốc thử cho phương pháp nhuộm Gram (xem A.1).

3.3. Thuốc thử và vật liệu th dùng cho phương pháp PCR.

3.3.1. Cặp mồi (primes), gồm mồi xuôi và mồi ngược.

3.3.2. Agarose.

3.3.3. Dung dịch đệm TAE (Tris-brorate - EDTA) hoặc TBE (Tris-acetate - EDTA) (xem A.2).

3.3.4. Chất nhuộm màu, ví dụ: Sybr safe.

3.3.5. Chất đệm tải mẫu (Loading dye 6X)

3.3.6. Dung dịch đệm TE (Tris-EDTA).

3.3.7. Thang chuẩn ADN (Marker)

3.3.8. Nước tinh khiết, không có nuclease.

3.3.9. Kít nhân gen (PCR Master Mix Kit).

3.3.10. Kít tách chiết ADN (acid deoxyribo nucleic), protein K.

4. Thiết bị, dụng cụ

Sử dụng thiết bị, dụng cụ thông thường của phòng thử nghiệm sinh học và những thiết bị, dụng cụ sau:

4.1. Thiết bị, dụng cụ dùng cho phương pháp giám định sinh hóa.

4.1.1. Phiến kính vô trùng.

4.1.2. Lamen vô trùng.

4.1.3. Kính hiển vi quang học, vật kính 10 X, 20X, 40 X và 100 X.

4.1.4. Tủ ấm, duy trì ở nhiệt độ 23 °C.

4.1.5. Nồi hấp, có thể duy trì nhiệt độ 115°C.

4.2. Thiết bị, dụng cụ dùng cho phương pháp chn đoán bằng PCR.

4.2.1. Máy nhân gen (PCR).

4.2.2. Máy ly tâm, có thể ly tâm với gia tốc 6 000 g và 20 000 g.

4.2.3. Máy lắc trộn vortex.

4.2.4. Máy spindown.

4.2.5. Bộ điện di, gồm bộ nguồn và bể chạy điện di.

4.2.6. Máy đọc gel.

5. Chẩn đoán lâm sàng

5.1. Đặc điểm dịch tễ.

Việt Nam, các loài cá nuôi lồng, bè và ao hồ nước ngọt đều có thể bị bệnh như: cá ba sa, cá tra, cá trắm cỏ, cá rô phi, cá bống tượng...

Cá bị nhiễm Aeromonas hydrophila từ 1 tuần đến 2 tuần có thể chết, tỷ lệ chết thường từ 30 % đến 70 %;

Bệnh có thể xảy ra các giai đoạn khác nhau từ cá giống, cá thịt, cá bố mẹ;

Tại Việt Nam, bệnh xuất hiện quanh năm nhưng thường hay xảy ra vào mùa xuân, mùa thu ở miền Bắc và đầu mùa mưa ở miền Nam khi nhiệt độ môi trường từ 25 °C đến 28 °C.

5.2. Triệu chứng làm sàng.

Cá bị bệnh có biểu hiện kém ăn hoặc bỏ ăn, nổi lờ đờ trên tầng nước mặt, da cá thường đổi màu tối không có ánh bạc, cá mất nhớt, khô ráp, rụng vẩy để lộ da bị xuất huyết;

Xuất hiện các đốm xuất huyết trên thân, gốc vây, quanh miệng, râu xuất huyết hoặc bạc trắng;

Xuất hiện các vết loét ăn sâu vào cơ, có mùi hôi thối, trên vết loét thường có nấm và ký sinh trùng ký sinh;

Mắt lồi đục, hậu môn viêm xuất huyết, bụng chướng to, các vây xơ rách, tia vây cụt dần.

5.3. Bệnh tích.

Ruột có thể đầy hơi và hoại tử;

Xoang bụng xuất huyết, gan tái nhợt, mật sưng to, thận sưng.

6. Chẩn đoán trong phòng thí nghiệm

6.1. Giám định Aeromonas hydrophila bằng phương pháp nuôi cấy và phân lập vi khuẩn.

6.1.1. Lấy mẫu.

- Thu mẫu cá có dấu hiệu bệnh lý, còn sống hoặc vừa mới chết.

- Bệnh phẩm:

+ Cá nguyên con;

+ Gan, thận, lách.

- Số lượng cá trên mỗi mẫu phụ thuộc vào kích cỡ của cá:

+ Cá giống: lấy từ 3 con/mẫu đến 5 con/mẫu;

+ Cá trưng thành, cá b mẹ: lấy 1 con/mẫu.

- Lấy mẫu mỗi loại bệnh phẩm, cho vào từng lọ hay túi nilon vô trùng riêng biệt, đậy kín, thao tác lấy mẫu, dụng cụ đựng mẫu và tiếp xúc với mẫu phải đảm bảo vô trùng.

6.1.2. Bảo quản mẫu.

- Trong quá trình vận chuyển, mẫu được bảo quản nhiệt độ từ 2 °C đến 8 °C không quá 24 h

- Mẫu chuyển đến phòng thí nghiệm phải được phân tích ngay.

6.1.3. Chuẩn bị mẫu.

- Bệnh phẩm: cá nguyên con vô trùng bên ngoài bề mặt cá bằng etanol 70 % (thể tích) (3.1.1), dùng panh, kéo vô trùng m để bộc lộ tổ chức bên trong, sau đó dùng bông cồn để thấm và vô trùng bề mặt của t chức định lấy (gan, thận, lách).

- Bệnh phẩm: gan, thận, lách vô trùng bề mặt của tổ chc định lấy.

6.1.4. Cách tiến hành.

6.1.4.1. Phân lập vi khun.

- Dùng que cấy chọc sâu xuống vị trí vô trùng ở mục (6.1.3) để lấy bệnh phẩm cấy trên môi trường thạch chọn lọc cho Aeromonas spp. Rimler-Shotts (R-S) (3.2.2).

- đĩa thạch đã cấy mẫu trong tủ ấm (4.1.4) từ 18 h đến 24 h. Trên môi trường thch Rimler-Shotts khuẩn lạc có dạng tròn, lồi, nhẵn có màu vàng nhạt.

- Chọn khuẩn lạc điển hình cấy vào môi trường NA (3.2.1). trong t ấm (4.1.4) để kiểm tra hình thái và xác định các đặc tính sinh hóa của vi khuẩn. Trên môi trường NA, khuẩn lạc của Aeromonas hydrophila có dng hình tròn, hơi lồi, nhẵn và có màu trắng đục

6.1.4.2. Xác định vi khuẩn.

6.1.4.2.1. Quan sát hình thái.

- Dùng que cấy lấy khuẩn lạc hòa đều vào giọt nước sinh lý trên phiến kính (4.1.1), dàn mng, để khô và cố định tiêu bản trên ngọn lửa đèn cồn;

- Tiêu bản sau khi đã được cố đnh, nhuộm bng phương pháp Gram (xem Phụ lục A);

- Aeromonas hydrophila bắt màu hồng (màu gram âm), hình que ngắn, hai đầu tròn, kích thước 0,5 µm x (từ 1,0 µm đến 1,5 µm).

6.1.4.2.2. Xác định đặc tính sinh hóa.

- Định danh vi khuẩn bằng phương pháp sinh hóa truyền thống: Xác định vi khuẩn dựa vào một số chỉ tiêu cơ bản: Vi khuẩn gram âm, oxidase dương tính, catalase dương tính và một số đặc tính sinh hóa đặc trưng được trình bày trong Bảng 1. Tiến hành các phản ứng sinh hóa (xem Phụ lục B).

Bảng 1 - Một số đặc tính sinh hóa đặc trưng của Aeromonas hydrophila

Sinh indol

Sử dụng glucose

Sử dụng sucrose

Sử dụng manitol

Sử dụng lactose

Sinh H2S

Sử dụng citrat

Phân hủy ornithine

Sinh khí từ glucose

Sử dụng urê

Di động

O/F

+

+

+

+

-/+

-

+

+

+

-

+

+/+

- Định danh vi khuẩn bằng kít thương mại (ví dụ bộ kít API 20E): Xác định vi khuẩn dựa vào một số chỉ tiêu cơ bản: Vi khuẩn gram âm, oxidase dương tính, catalase dương tính, O/F dương tính và các ch tiêu sinh hóa nêu trong Bảng 2. Tiến hành các phản ứng sinh hóa bằng bộ kít API 20E (tham khảo Phụ lục C).

Bảng 2 - Các chỉ tiêu sinh hóa ca Aeromonas hydrophila qua bộ kít API 20E

ONPG

ADH

LDC

ODC

CIT

H2S

URE

TDA

IND

VP

+

+

+

-

+

-

-

-

+

-

GEL

GLU

MAN

INO

SOR

RHA

SAC

MEL

AMY

ARA

+

+

+

-

-

-

+

-

+

-

6.1.4.3. Đọc kết quả.

Cá được xác định là nhiễm bệnh do Aeromonas hydrophila khi nuôi cấy, phân lập, định danh bằng phương pháp sinh hóa truyền thống hoặc nuôi cấy, phân lập, định danh được Aeromonas hydrophila bằng bộ kít thương mại.

6.2. Xác định Aeromonas hydrophila bằng phương pháp PCR (Polymerase Chain Reaction).

6.2.1. Lấy mẫu.

6.2.1.1. Lấy mẫu trực tiếp.

Xem 6.1.1.

6.2.1.2. Lấy mẫu nuôi cy.

Mẫu vi khuẩn: lấy khuẩn lạc trên môi trường nuôi cấy (xem 6.1.4.1).

6.2.2. Bo qun mẫu.

Trong quá trình vận chuyển, mẫu được bảo quản nhiệt độ từ 2°C đến 8 °C không quá 48 h hoặc bảo quản trong etanol tuyệt đối (3.1.1).

Mẫu chuyển đến phòng thí nghiệm nếu chưa phân tích ngay phải được bảo qun ở nhiệt độ âm 20 °C đến âm 80 °C hoặc trong etanol tuyệt đi (3.1.1).

6.2.3. Chuẩn bị mẫu.

Xem 6.1.3.

Lượng mẫu cần chuẩn bị: khoảng 30 mg.

6.2.4. Cách tiến hành.

6.2.4.1. Tách chiết ADN.

S dụng bộ kít tách chiết (3.2.10) thích hợp và an toàn theo hướng dẫn ca nhà sản xuất.

DỤ: S dụng kít tách chiết DNeasy® Blood & Tissue Kit (250) (Cat No. 69506)1) (xem phụ lục D).

6.2.4.2. Chuẩn bị mồi.

Phản ứng khuếch đại được thực hiện trong máy nhân gen (4.2.1) theo phương pháp PCR khuếch đại đoạn gen đặc hiệu của bệnh nhiễm trùng do Aeromonas hydrophila sử dụng cặp mồi AeroFd/AeroRs (3.3.1). Trình tự cặp mồi được nêu trong Bng 3.

Bảng 3 - Trình tự cặp mồi[9]

Mồi

Trình tự cặp mồi

AeroPd (mồi xuôi)

5 - CCAAGGGGTCTGTGGCGACA - 3

AeroRs (mồi ngược)

5- TTTCACCGGTAACAGGATTG - 3’

Mồi được chuẩn bị như sau:

Chuẩn bị mồi gốc:

- Mồi trạng thái đông khô phải được ly tâm nhanh bằng máy spindown (4.2.4) ở gia tốc 6 000g trong 30 s để mồi lắng xuống đáy ống trước khi m và hoàn nguyên. Khi hoàn nguyên, nên dùng đệm TE (3.2.6) để hoàn nguyên mồi ở nồng độ 200 µM làm mồi gốc.

Chuẩn bị mồi sử dụng:

- Mồi sử dụng nồng độ 20 µM: pha loãng mồi gốc bằng nước (3.2.8) (10 µl mồi gốc và 90 µl nước).

6.2.4.3. Tiến hành phn ứng PCR.

Sử dụng cặp mồi đã chuẩn bị (6.2.4.2) sử dụng kít nhân gen (3.2.9) theo hướng dẫn của nhà sản xuất.

DỤ: Sử dụng kít nhân gen của Thermo Scientific Dream Tag PCR Master Mix (2X) (Lot: 00316656)2)

Thành phần cho 1 phản ứng được nêu trong bảng 4

Bảng 4: Thành phần phản ứng PCR

Thành phần

Th tích

Taq PCR Master Mix Kit

12,5 µl

Mồi xuôi 20 µM

1 µl

Mồi ngược 20 µM

1 µl

Nước không có nuclease

8 µl

Tng thể tích

22,5 µl

Chuyển 22,5 µl hỗn hợp nhân gen vào mỗi ống phản ứng:

- Mẫu kiểm chứng dương: Cho 2,5 µl mẫu ADN đã được giám định hoặc sử dụng các chủng Aeromonas hydrophila chuẩn;

- Mẫu kiểm chứng âm: Cho 2,5 µl nước tinh khiết không có nucleasa (3.2.8) vào ống phản ng;

- Mẫu thử: Cho 2,5 µl mẫu ADN kiểm tra vào ống phản ứng.

Tiến hành phản ứng PCR bằng máy nhân gen (4.2.1)

Bng 5: Chu trình nhiệt của phản ứng PCR [9]

Nhiệt độ

Thời gian

Số chu kỳ

95 °C

4 min

1

95 °C

30 s

30

54 °C

45 s

72 °C

30 s

72 °C

10 min

1

CHÚ THÍCH:

- Phán ng PCR phi bao gồm: mẫu kiểm tra, mẫu kiểm chứng dương và mẫu kim chứng âm;

- Mẫu và nguyên liệu cho phản ng PCR cần đặt trong khay đá lạnh trong suốt quá trình chuẩn bị hỗn hợp phản ứng.

6.2.4.4. Điện di.

6.2.4.4.1. Chuẩn bị bn gel.

Pha thạch với nồng độ agarose (3.2.2) từ 1,5 % đến 2 % bằng dung dịch đệm TBE 1X hoặc TAE 1X (3.3.3) vào chai thủy tinh 250 ml, lắc đều rồi đun sôi;

Khi nhiệt độ giảm xuống khoảng 40 °C đến 50 °C thì bổ sung 10 µl chất nhuộm màu (3.3.4) cho 100 ml thạch. Lắc nhẹ tránh tạo bọt để chất nhuộm màu tan đều;

Tiến hành đổ thạch vào khay điện di đã được cài lược; không nên đổ bản thạch dày quá 0,8 cm;

Khi bản thạch đông lại thì tiến hành gỡ lược khỏi bản thạch;

Chuyển bản gel vào bể điện di (4.2.5), đổ dung dịch đệm (3.3.4) cùng loại với dung dịch pha thạch agarose đã đun vào bể điện di cho tới khi ngập bản thạch.

CHÚ THÍCH: Có thể dùng các sản phẩm có sẵn chất nhuộm ADN để pha chế thạch agaross (ví dụ: Sybr safe ADN gel stain 3)) và s dụng theo quy đnh của nhà sn xuất.

6.2.4.4.2. Chạy điện di.

Hút 2 µl chất đệm tải mẫu (3.3.5) vào 8 µl sản phẩm PCR trộn đều và cho vào các giếng trên bản thạch.

Thực hiện điện di trong bô điện di (4.2.5) chạy kèm theo thang chuẩn ADN (3.3.7) để dự đoán kích thước sản phẩm khuếch đại. Hút 10 µl thang chuẩn ADN (3.3.7) vào một giếng trên bản thạch.

Điện di ở hiệu điện thế 100 V trong thời gian 30 min.

6.2.4.5. Đọc kết quả.

Sau khi điện di, đọc kết quả trên máy đọc gel (4.2.6) theo bảng 6.

Bảng 6: Kết quả điện di

Giếng

Sản phẩm có kích thước 209 bp

Kết quả

Thang chuẩn

Sáng và chia vạch rõ ràng

Điện di tốt

Mẫu kiểm chứng dương

Có

Hỗn hợp phn ứng PCR tốt

Không

Mu đối chứng dương tính hỏng hoặc enzym hỏng

Mu kiểm chứng âm

Không

Không tp nhiễm

Bị tạp nhiễm

Mẫu thử

Dương tính với A. hydrophila

Không

Âm tính với A. hydrophila

Đánh giá kết quả:

- Kết quả mẫu th dương tính khi: Tại giếng mẫu thử xuất hiện vạch sáng có kích thước bằng kích thước giống mẫu kiểm chứng dương có kích thước 209 bp. Thang chuẩn phân vạch rõ ràng, mẫu kiểm chứng âm không có vạch sáng.

- Kết quả mẫu thử âm tính khi: Tại giếng mẫu thử không có vạch sáng, thang chun ADN phân vạch rõ ràng, mẫu kiểm chứng dương tính có vạch sáng 209 bp, mẫu kiểm chứng âm không có vạch sáng.

7. Kết luận

Cá được xác định là nhiễm bệnh do Aeromonas hydrophila khi có đặc điểm dịch tễ, triệu chứng lâm sàng, bệnh tích điển hình của bệnh và có kết quả dương tính một trong hai phương pháp sau:

- Phản ứng PCR phát hiện Aeromonas hydrophila dương tính;

- Nuôi cấy, phân lập và định danh được Aeromonas hydrophila.

 

PHỤ LỤC A

(Quy định)

Thành phần và chuẩn bị thuốc thử

A. 1. Thuốc thử cho phương pháp nhuộm Gram

A. 1.1. Thuốc thử

A. 1.1.1. Dung dịch tím tinh thể

Thành phần

Tím tinh thể                                    2,0 g

Cồn tuyệt đối                             20,0 ml

Amoni oxalat                                 0,8 g

Nước                                         80,0 ml

Chuẩn bị

Hòa tan tím tinh th trong etanol và hòa tan amoni oxalat trong nước. Sau đó, trộn 2 dung dịch này với nhau và lắc cho tan hết.

A.1.1.2. Dung dịch Fuchsin đậm đặc

Thành phần

Fuchsin basic                                   1 g

Cồn tuyệt đi                                10 ml

Phenol                                             5 g

Nước                                          100 ml

Chuẩn bị

Hòa tan các thành phần trong nước. Khi dùng, pha loãng dung dịch fuchsin đậm đặc với nước theo tỉ lệ thể tích 1:10.

A.1.1.3. Dung dịch lugol

Thành phần

Kali iodua                                         2 g

l-ốt tinh thể                                       1 g

Nước                                          200 ml

Chuẩn bị

Nghiền kali iodua và iodine tinh thể, cho nước vào từ từ và lắc cho tan.

A.1.1.4. Cn axeton

Trộn đầu dung dịch cồn tuyệt đối với dung dịch axeton với tỷ lệ thể tích 3:1.

A.1.2. Cách tiến hành

Nhỏ dung dịch tím tinh thể (A.1.1) lên tiêu bản, để từ 1 min đến 2 min sau đó rửa nước nhanh và đ khô;

Nhỏ dung dịch lugol (A.1.3), để 1 min sau đó rửa nước nhanh và để khô;

Nh cồn axeton (A.1.4), rửa nước thật nhanh và để khô;

Nhỏ dung dịch fuchsin loãng, để 1 min sau đó rửa nước và để khô.

A.1.3. Xem tiêu bản

Nh 1 giọt dầu vào tiêu bản và xem tiêu bản bằng kính hiển vi quang học (4.1.3) có vật kính có độ phóng đại 100 X.

A.2. Dung dịch đệm TAE hoặc TBE

A.2.1. Thành phn

Dung dịch TAE (hoặc TBE) 10X:               100 ml

Nước khử ion:                                         900 ml

Tổng:               1000 ml dung dịch TAE (TBE) 1X

A. 2.2. Chuẩn bị

Ly 100 ml dung dịch TAE (TBE) 10X (3.3.3) hòa chung với 900 ml nước kh ion, khuấy và lắc đều.

Bảo quản ở nhiệt độ phòng.

 

PHỤ LỤC B

(Quy định)

Các phản ứng sinh hóa của Aeromonas hydrophila

B.1. Nguyên liệu cho giám định sinh hóa

B.1.1. Môi trường nước pepton

Chuẩn bị môi trường nước pepton theo hướng dẫn của nhà sản xuất.

B.1.2. Thuốc thử Kovac’s

B.1.2.1. Thành phần

Paradimetyl aminobenzaldehyt                      5 g

Cồn amylic                                                75 ml

Axit clohydric đặc                                     25 ml

B.1.2.2. Chuẩn bị

Trộn dung dịch paradimetyl aminobenzaldehyt vào cồn amylic cho tan hết và để trong tủ lạnh. Thêm từ từ 5 ml đến 10 ml axit clohydric đặc, trộn đều rồi để tủ lạnh, sau đó tiếp tục bổ sung axit clohydric đặc.

Bảo quản thuốc thử trong lọ màu, 4 °C.

CHÚ THÍCH: Có thể s dụng thuốc thử Kovac's thương mại và làm theo hướng dẫn của nhà sản xuất.

B.1.3. Thuốc thử H2O2, 3 %.

B.1.4. Môi trường nước pepton - đường

B.1.4.1. Thành phần

- Nước pepton;

- Dung dịch chỉ thị màu bromocrezol: cho 0,2 g bromocrezol vào 100 ml etanol 90 % (thể tích) và lắc cho tan hết;

- Dung dịch đường: glucose, sucrose.

B.1.4.2. Chuẩn bị

Pha glucose hoặc sucrose thành dung dịch 10 % (trong nước), hấp tiệt trùng môi trường bằng nồi hấp (4.1.5) 115 °C trong 15 min hoặc hấp cách quãng 3 lần ở 100 °C trong 30 min hoặc lọc qua màng lọc có kích thước lỗ lọc 0,45 µm.

Cho 0,1 ml chỉ thị màu bromocrezol vào 100 ml môi trường nước pepton, chia ra các ống (4 ml mỗi ống). Hấp tiệt trùng bằng nồi hấp (4.1.5) ở 120 °C trong 30 min. Chỉnh pH môi trường ở 6,8 ± 0,2.

Thêm 0,4 ml dung dịch đường 10 % vào ống chứa 4 ml môi trường.

B.1.5. Môi trường thạch TSI (Tripie Sugar Iron agar)

Chuẩn bị môi trường thạch TSI (theo hướng dẫn của nhả sản xuất);

Thạch nghiêng chế từ TSI: thạch màu đỏ và có 2 phần: phần thạch đứng bên dưới để kiểm tra khả năng lên men glucose, sinh hơi, sinh H2S, phần thạch nghiêng để kiểm tra khả năng lên men đường lactose.

B.1.6. Môi trường thạch urê

Có thể sử dụng môi trường urê cơ bản (urea agar base - Christensen). Chuẩn bị môi trường và bổ sung urê theo hướng dẫn ca nhà sản xuất.

B.1.7. Môi trường thạch lỏng kiểm tra khả năng di động

B.1.7.1. Thành phn

Pepton                                                       10 g

Chất chiết thịt                                               3 g

Natri clorua                                                   5 g

Thạch                                                           4 g

Gelatin                                                       80 g

Nước cất                                               1000 ml

B.1.7.2. Chuẩn bị

Hòa gelatine vào nước để 30 min, bổ sung các thành phần khác, đun cho tan hoàn toàn. Chia ra các ống nghiệm khoảng 6 ml/ống. Hấp tiệt trùng trong nồi hấp (4.1.5) ở 115 °C trong 15 min.

B.1.8. Môi trường ornithine decacbolxylase

B.1.8.1. Thành phần

Pepton                                                      0,5 g

Chất chiết nấm men                                   0,3 g

Glucose                                                    0,1 g

Chỉ thị bromocresol đỏ tía 0,2 %               0,1 ml

L-ornithin clohydric                                     0,5 g

Nước                                                      100 ml

B.1.8.2. Chuẩn bị

Hòa tan pepton, chất chiết nấm men, glucose trong nước, chỉnh môi trường về pH = 6,7 và thêm chất chỉ thị màu bromocresol đỏ tía 0,2 %. Hấp môi trường trong nồi hấp (4.1.5) ở 115 °C trong 15 min.

Bổ sung thêm L-ornithine hydrochloride 0,5%. Chỉnh lại pH môi trường về 6,7. Chia môi trường ra các ống nghiệm, mỗi ống nghiệm khoảng 2 ml.

Hấp tiệt trùng trong nồi hấp (4.1.5) 115 °C trong 15 min.

B.1.9. Môi trường OF

B.1.9.1. Thành phần

Thạch OF                                                     1 g

Glucose                                                       2 g

Nước cất                                                100 ml

B.1.9.2. Chuẩn bị

Hòa các thành phần trên vào lọ sạch, đun cho tan hoàn toàn.

Chia ra các ống nghiệm, mỗi ống 6 ml.

Hấp tiệt trùng trong nồi hấp (4.1.5) 115 oC trong 15 min.

B.1.10. Thuốc thử cho phản ứng Oxidase

B.2. Cách tiến hành

Tiến hành định danh vi Khuẩn theo phương pháp truyền thống hoặc sử dụng kit sinh hóa API 20 E.s

B.2.1. Phương pháp sinh hóa truyền thống

B.2.1.1. Phản ứng sinh indol

Dùng que cấy lấy khuẩn lạc cấy vào môi trường nước pepton (B.1.1). trong t m (4.1.4). Sau 24 h, nhỏ từ 0,2 ml đến 0,3 ml dung dịch thuốc thử Kovac’s (B. 1.2) vào môi trường, lắc nhẹ.

Đọc kết quả:

- Phn ứng dương tính (sinh indol): xuất hiện vòng màu đỏ phía trên môi trường;

- Phản ứng âm tính (không sinh indol): không xuất hiện vòng màu đỏ.

B.2.1.2. Phản ứng catalase

Nh một giọt dung dịch H2O2 3 % (B.1.3) lên phiến kính (4.1.1). Dùng que cấy lấy khuẩn lạc nghi ng cho vào giọt dung dịch H2O2 3 %.

Đọc kết quả sau 5 s:

- Phản ứng dương tính: có hiện tượng sủi bọt;

- Phản ứng âm tính: không có hiện tượng sủi bọt.

B.2.1.3. Kiểm tra đặc tính lên men glucose và sinh H2S trên môi trường thạch TSI

Dùng que cấy chích sâu lấy khuẩn lạc cấy thẳng (chính giữa phần thạch đứng) xuống đáy ống nghiệm môi trường thạch TSI (B.1.5). trong tủ ấm (4.1.4), sau 24 h đọc kết quả.

Lên men glucose:

- Phản ứng dương tính: phần đứng cửa môi trường thạch chuyển sang màu vàng;

- Phản ứng âm tính: phần đứng của môi trường thạch không chuyển màu.

Khả năng sinh H2S:

- Phản ứng dương tính: đáy ống nghiệm có màu đen;

- Phản ứng âm tính: đáy ống nghiệm không có màu đen.

B.2.1.4. Kiểm tra đặc tính lên men sucrose hoặc glucose

Dùng que cấy lấy khuẩn lạc cấy vào ống môi trường nước pepton có sucrose hoặc glucose (B.1.4).

trong tủ ấm (4.1.4), đọc kết quả sau 24 h:

- Phản ng dương tính: môi trường chuyn màu vàng;

- Phản ứng âm tính: môi trường không thay đổi màu.

B.2.1.5. Kiểm tra khả năng phân giải urê

Dùng que cấy lấy khun lạc cấy vào môi trường thạch urê (B.1.6).

trong t ấm (4.1.4), đọc kết quả sau 24 h:

- Phản ứng dương tính: môi trường chuyển sang màu hồng;

- Phản ứng âm tính: môi trường không chuyn màu.

B.2.1.6. Kiểm tra khả năng di động của vi khuẩn bằng môi trường thạch lng

Dùng que cấy chích sâu lấy khuẩn lạc cấy thẳng xuống gần đáy của ống nghiệm có môi trường thạch lỏng (B.1.7).

trong tủ ấm (4.1.4), đọc kết quả sau 24 h:

- Phản ứng dương tính (có khả năng di động): môi trường đục, không nhìn rõ đường cấy chích sâu;

- Phản ứng âm tính: môi trường trong và nhìn thấy đường cấy chích sâu.

B.2.1.7. Kiểm tra khả năng phân hủy ornithine

Dùng que cấy lấy khuẩn lạc cấy vào môi trường có chứa ornithine decarboxylase (B.1.8).

trong tủ ấm (4.1.4), sau 24 h đọc kết quả:

- Dương tính: môi trường chuyển màu tím;

- Âm tính: môi trường có màu vàng

B.2.1.8. Thử phản ứng Oxidase

Đặt miếng giấy lọc có thấm thuốc thử vào đĩa lồng.

Dùng que cấy vô trùng lấy vi khun cần nghiên cứu đã thuần chủng nuôi cấy sau 24 h bôi lên miếng giấy lọc có thuốc thử.

Đọc kết quả sau 10 s đến 30 s.

- Phản ứng dương tính: Vi khuẩn có màu xanh tím là dương tính (+).

- Phản ứng âm tính: Vi khuẩn không thay đổi màu sắc là âm tính (-).

B.2.1.9. Thử khả năng lên men và oxy hóa của vi khuẩn (O/F)

Dùng que cấy vô trùng lấy vi khuẩn từ ống nghiệm đã thuần chủng nuôi cấy sau 24 h, cấy vào hai ống nghiệm có chứa môi trường OF.

Một ống được ph một lớp parafin lng dày khoảng 1 cm. Nuôi cấy trong tủ ấm (4.1.5).

Đọc kết quả sau 24 h đến 48 h như sau:

- Vi khuẩn có khả năng lên men: cả hai ống đều chuyển màu vàng.

- Vi khuẩn có khả năng oxy hóa: ống không phù dầu có màu vàng, ống phủ parafin có màu xanh.

- Vi khuẩn không có khả năng oxy hóa và lên men: Cả hai ống vẫn giữ nguyên màu xanh của môi trường.

 

PHỤ LỤC C

(Tham khảo)

Định danh vi khuẩn bằng bộ kít API 20 E

C.1. Cách tiến hành

Dùng que tiệt trùng lấy một ít khuẩn lạc cho vào 5 ml nước muối sinh lý hoặc nước cất tiệt trùng, lắc trộn đều.

Cho một ít nước vào khay nhựa của bộ kít để giữ m khi ủ trong tủ m (4.1.5).

Dùng pipet với đầu týp tiệt trùng hút dung dịch vi khun cho vào mỗi ô của bộ kít. Nh dung dịch vi khuẩn vừa đủ vào tất cả các ô CIT, VP, GEL thì nh đầy, 5 ô ADH, LDC, ODC, H2S và URE cho thêm Parafin tiệt trùng để tạo điều kiện yếm khí.

Đậy nắp khay lại và ủ trong tủ ấm (4.1.5).

C.2. Đọc kết quả

Đọc kết quả sau 18 h đến 24 h

- Kiểm tra và ghi nhận tất cả các chỉ tiêu không cần cho thêm thuốc thử đọc kết quả dựa vào Bảng C.1.

- Các chỉ tiêu cần sử dụng thuốc thử

+ TDA: Nhỏ một giọt thuốc thử TDA. Màu đen xuất hiện thì kết quả là phản ứng dương tính, màu vàng thì kết quả phản ứng âm tính.

+ IND: Nh một giọt thuốc thử JAMES. Đợi 2 min, xuất hiện một vòng màu đỏ là phản ứng dương tính, màu vàng là âm tính

+ VP: Thêm một giọt lần lượt mỗi dung dịch thuốc thử VP1, VP2. Đợi ít nhất 10 min, màu hồng hoặc đỏ xuất hiện là phản ứng dương tính. Nếu màu hồng nhạt xuất hiện trong vòng 10 min đến 12 min là phản ứng âm tính.

Bảng C.1 - Các chỉ tiêu định danh Aeromonas hydrophila bằng bộ kít API 20 E

Ch tiêu

Âm tính

Dương tính

ONPG

Không máu

Vàng

ADH

Vàng

Đỏ/ cam

LDC

Vàng

Đỏ/ cam

ODC

Vàng

Đỏ/ cam

CIT

Vàng

Xanh/ xanh lá

H2S

Không màu

Đen

URE

Vàng

Đ/ cam

TDA

Vàng

Nâu sậm

IND

Vàng

Đỏ (2 min)

VP

Không màu

Hồng/ đỏ (10 min)

GEL

Không màu (còn kết tủa đen)

Đen

GLU

Xanh/ xanh lá

Vàng

MAN

Xanh/ xanh lá

Vàng

INO

Xanh/ xanh lá

Vàng

SOR

Xanh/ xanh lá

Vàng

RHA

Xanh/ xanh lá

Vàng

SAC

Xanh/ xanh lá

Vàng

MEL

Xanh/ xanh lá

Vàng

AMY

Xanh/ xanh lá

Vàng

 

PHỤ LỤC D

(Tham khảo)

Quy trình tách chiết ADN

CẢNH BÁO: Việc tách chiết ADN có sử dụng hóa chất nguy hiểm và có kh năng gây hại nếu thao tác không cẩn thận. Do vậy, nên tránh tiếp xúc trực tiếp với da và hít phải hơi của các hóa chất này. Luôn luôn đeo găng tay, khẩu trang, mặc quần áo bảo hộ khi thực hiện các thao tác này.

Quy trình tách chiết ADN sử dụng kit tách chiết DNeasy® Blood & Tissue Kit (250) (Cat No. 69506):

- Nhỏ 20 µl protease K vào ống ly tâm 1,5 ml;

- Chuyển 30 mg mẫu bệnh phẩm (6.2.3) vào ống ly tâm đã có protease K;

- Thêm 200 µl dung dịch AL (Lysis buffer);

- Trộn kỹ huyễn dịch trong 15 s, sau đó ly tâm nhanh bằng máy spindown (4.2.4);

- ấm 56 °C trong 10 min, sau đó ly tâm nhanh bằng máy spindown (4.2.4);

- Thêm 200 µl etanol tuyệt đối vào ống ly tâm;

- Trộn kỹ huyễn dịch trong 15 s, sau đó ly tâm nhanh bằng máy spindown (4.2.4);

- Hút 420 µl huyễn dịch trong ống ly tâm trên, chuyển sang cột ly tâm có ống thu dưới;

- Ly tâm bằng máy ly tâm (4.2.2) với gia tốc 6 000 g trong 1 min ở nhiệt độ phòng;

- Thêm 500 µl dung dịch AW1 (Wash buffer 1) vào cột ly tâm có ống thu ở dưới;

- Ly tâm bằng máy ly tâm (4.2.2) với gia tốc 6 000 g trong 1 min ở nhiệt độ phòng;

- Thay ống thu dưới cột ly tâm;

- Thêm 500 µl dung dịch AW2 (Wash buffer 2) vào cột ly tâm có ống thu dưới;

- Ly tâm bằng máy ly tâm (4.2.2) với gia tốc 20 000 g trong 3 min nhiệt độ phòng;

- Chuyển cột ly tâm sang ống ly tâm 1,5 ml;

- Nh 200 µl dung dịch AE (Elution buffer) vào cột ly tâm và giữ nhiệt độ phòng 1 min;

- Ly tâm bằng máy ly tâm (4.2.2) với gia tốc 6 000 g trong 1 min;

- Chuyển ADN đã thu được sang ống 1,5 ml khác.

 

THƯ MỤC TÀI LIỆU THAM KHẢO

[1] ThS. Từ Thanh Dung, TS Đặng Thị Hoàng Oanh, ThS Trần Thị Tuyết Hoa, Giáo trình bệnh học Thủy sản, 2005, trang 64-67.

[2] Đỗ Thị Hòa, Bùi Quang Tề, Nguyễn Hữu Dũng, Nguyễn Thị Muội, Bnh học Thủy sản, 2004, trang 218-223.

[3] Bùi Quang Tề, Thực hành chẩn đoán bệnh Thủy sản, 2007, trang 13-24.

[4] Bergey. Bergey’s Manual of Systematic bacteriology. Part B The Grammaproteobacteria, 557-572.

[5] Nicky B. Buller,. Bacteria from Fish and Other Aquatic Animals 2004, p197.

[6] M. J. A. Sarkar and M. M. Rashid, Pathogenicity of the bacterial isolate Aeromonas hydrophila to catfishes, carps and perch, 2012, p 157-161.

[7] T.Raja Swaminathan, Gaurav Rathore, Rehana Abidi and D. Kapoor, Detection of Aeromonas hydrophila by polymerase chain reaction, 2004, 251-254.

[8] Trần Nguyễn Diễm Tú và Đặng Thị Hoàng Oanh, Chuẩn hóa quy trình phát hiện vi khuẩn Edwardsiella ictaluri, Aeromonas hydrophilaFlavobacterium columnare từ máu cá tra, tạp chí khoa học 2012.

[9] Victor S. Panangala, Craig A. Shoemaker, Vicky L.van Santen, Kevin Dybvig, Phillip H. Klesius, Multiplex-PCR for simultaneous detection of 3 bacterial fish pathogens, Flavobacterium columnare, Edwardsiella ictaluri, and Aeromonas hydrophila, Diseases of aquatic organisms, 2007, Vol. 74: 199-208.



1) Thông tin này đưa ra tạo điu kiện thuận tiện cho người sử dụng tiêu chuẩn và không ấn định sử dụng sản phẩm ca nhà cung cp này. Có thể sử dụng các sn phẩm tương tự nếu cho các kết qu tương đương.

2) Thông tin này đưa ra tạo điều kiện thuận tiện cho người sử dụng tiêu chuẩn và không ấn định sử dụng sản phẩm của nhà cung cấp này. Có th sử dụng các sản phẩm tương tự nếu cho các kết quả tương đương.

3) Thông tin này đưa ra tạo điều kiện thuận tiện cho người s dụng tiêu chuẩn và không n định sử dụng sản phẩm này. Có thể sử dụng các sản phẩm tương tự nếu cho các kết quả tương đương.

Tìm kiếm

Thông tin Tiêu chuẩn Việt Nam TCVN8710-15:2015
Loại văn bảnTiêu chuẩn Việt Nam
Số hiệuTCVN8710-15:2015
Cơ quan ban hành
Người ký***
Lĩnh vựcNông nghiệp
Ngày ban hành...
Ngày hiệu lực...
Tình trạng hiệu lựcKhông xác định
Cập nhật3 năm trước